EMAIL THIS PAGE TO A FRIEND

TIGD3

tigger transposable element derived 3

UniProtKB ID: Q6B0B8
Gene ID:
Human(220359) Summary: The protein encoded by this gene belongs to the tigger subfamily of the pogo superfamily of DNA-mediated transposons in humans. These proteins are related to DNA transposons found in fungi and nematodes, and more distantly to the Tc1 and mariner transposases. They are also very similar to the major mammalian centromere protein B. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
Mouse(332359) tigger transposable element derived 3
Rat(309174) tigger transposable element derived 3
domestic guinea pig(100723809) tigger transposable element derived 3
naked mole-rat(101724208) tigger transposable element derived 3
cow(513236) tigger transposable element derived 3
cow(101903775) tigger transposable element derived 3
sheep(101107913) tigger transposable element derived 3
domestic cat(101097172) tigger transposable element derived 3
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145719 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145719 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145719 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198634 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198634 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198634 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145719 Rosetta Predictions human pricing
NM_001107573 Rosetta Predictions rat pricing
NM_198634 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145719 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224053 predicted 1554
2 SASI_Hs01_00224054 predicted 489
3 SASI_Hs01_00224055 predicted 477
4 SASI_Hs01_00224056 predicted 1047
5 SASI_Hs01_00224057 predicted 1499
6 SASI_Hs01_00224058 predicted 717
7 SASI_Hs01_00224059 predicted 879
8 SASI_Hs01_00224060 predicted 1366
9 SASI_Hs02_00365318 predicted 1622
10 SASI_Hs01_00224061 predicted 680
11 SASI_Hs01_00224062 predicted 720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107573 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230165 predicted 868
2 SASI_Rn02_00230166 predicted 494
3 SASI_Rn02_00230167 predicted 416
4 SASI_Rn02_00230168 predicted 1189
5 SASI_Rn02_00230169 predicted 515
6 SASI_Rn02_00230170 predicted 754
7 SASI_Rn02_00230171 predicted 302
8 SASI_Rn02_00230172 predicted 697
9 SASI_Rn02_00230173 predicted 760
10 SASI_Rn02_00230174 predicted 728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198634 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351093 predicted 734
2 SASI_Mm02_00351094 predicted 491
3 SASI_Mm02_00351095 predicted 1060
4 SASI_Mm02_00351096 predicted 934
5 SASI_Mm02_00351097 predicted 474
6 SASI_Mm02_00351098 predicted 394
7 SASI_Mm02_00351099 predicted 711
8 SASI_Mm02_00351100 predicted 1057
9 SASI_Mm02_00351101 predicted 215
10 SASI_Mm02_00351102 predicted 371
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145719
TIGD3 MISSION shRNA Bacterial Glycerol Stock
tigger transposable element derived 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145719.1-1602s1c1
Sequence:CCGGCCTCTCTTGTTTCCCATGGAACTCGAGTTCCATGGGAAACAAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145719.1-1388s1c1
Sequence:CCGGGATAGGCACTGAAGACGAGAACTCGAGTTCTCGTCTTCAGTGCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145719.1-1598s1c1
Sequence:CCGGCCTTCCTCTCTTGTTTCCCATCTCGAGATGGGAAACAAGAGAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145719.1-1478s1c1
Sequence:CCGGGAGGAGGTGGTTTGAATGCAACTCGAGTTGCATTCAAACCACCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145719.1-1648s1c1
Sequence:CCGGGCTGTCTCTTTCCTGTGGAAACTCGAGTTTCCACAGGAAAGAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145719.1-569s1c1
Sequence:CCGGCCATGTTCTTGCGCCTTCATTCTCGAGAATGAAGGCGCAAGAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145719.1-1361s1c1
Sequence:CCGGGCCAAGGTCTGGAGTATGTAACTCGAGTTACATACTCCAGACCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145719.1-1504s1c1
Sequence:CCGGCTTCTCCTGAGCTATTCGAAACTCGAGTTTCGAATAGCTCAGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145719.1-296s1c1
Sequence:CCGGCATCTGCAAGAATAAGGAGAACTCGAGTTCTCCTTATTCTTGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145719
TIGD3 MISSION shRNA shRNA Plasmid DNA
tigger transposable element derived 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145719.1-1602s1c1
Sequence:CCGGCCTCTCTTGTTTCCCATGGAACTCGAGTTCCATGGGAAACAAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145719.1-1388s1c1
Sequence:CCGGGATAGGCACTGAAGACGAGAACTCGAGTTCTCGTCTTCAGTGCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145719.1-1598s1c1
Sequence:CCGGCCTTCCTCTCTTGTTTCCCATCTCGAGATGGGAAACAAGAGAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145719.1-1478s1c1
Sequence:CCGGGAGGAGGTGGTTTGAATGCAACTCGAGTTGCATTCAAACCACCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145719.1-1648s1c1
Sequence:CCGGGCTGTCTCTTTCCTGTGGAAACTCGAGTTTCCACAGGAAAGAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145719.1-569s1c1
Sequence:CCGGCCATGTTCTTGCGCCTTCATTCTCGAGAATGAAGGCGCAAGAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145719.1-1361s1c1
Sequence:CCGGGCCAAGGTCTGGAGTATGTAACTCGAGTTACATACTCCAGACCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145719.1-1504s1c1
Sequence:CCGGCTTCTCCTGAGCTATTCGAAACTCGAGTTTCGAATAGCTCAGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145719.1-296s1c1
Sequence:CCGGCATCTGCAAGAATAAGGAGAACTCGAGTTCTCCTTATTCTTGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145719
TIGD3 MISSION shRNA Lentiviral Transduction Particles
tigger transposable element derived 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145719.1-1602s1c1
Sequence:CCGGCCTCTCTTGTTTCCCATGGAACTCGAGTTCCATGGGAAACAAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145719.1-1388s1c1
Sequence:CCGGGATAGGCACTGAAGACGAGAACTCGAGTTCTCGTCTTCAGTGCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145719.1-1598s1c1
Sequence:CCGGCCTTCCTCTCTTGTTTCCCATCTCGAGATGGGAAACAAGAGAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145719.1-1478s1c1
Sequence:CCGGGAGGAGGTGGTTTGAATGCAACTCGAGTTGCATTCAAACCACCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145719.1-1648s1c1
Sequence:CCGGGCTGTCTCTTTCCTGTGGAAACTCGAGTTTCCACAGGAAAGAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145719.1-569s1c1
Sequence:CCGGCCATGTTCTTGCGCCTTCATTCTCGAGAATGAAGGCGCAAGAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145719.1-1361s1c1
Sequence:CCGGGCCAAGGTCTGGAGTATGTAACTCGAGTTACATACTCCAGACCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145719.1-1504s1c1
Sequence:CCGGCTTCTCCTGAGCTATTCGAAACTCGAGTTTCGAATAGCTCAGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145719.1-296s1c1
Sequence:CCGGCATCTGCAAGAATAAGGAGAACTCGAGTTCTCCTTATTCTTGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198634
TIGD3 MISSION shRNA Bacterial Glycerol Stock
tigger transposable element derived 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198634.1-1813s1c1
Sequence:CCGGCTTAGTCTAAATAGGGTAGAACTCGAGTTCTACCCTATTTAGACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198634.1-537s1c1
Sequence:CCGGCGTCGAAACAATGTGGGCTTTCTCGAGAAAGCCCACATTGTTTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198634.1-536s1c1
Sequence:CCGGACGTCGAAACAATGTGGGCTTCTCGAGAAGCCCACATTGTTTCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198634.1-528s1c1
Sequence:CCGGCGCTGGAAACGTCGAAACAATCTCGAGATTGTTTCGACGTTTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198634.1-729s1c1
Sequence:CCGGGATCGGTTGCAAGTACTGTTACTCGAGTAACAGTACTTGCAACCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198634
TIGD3 MISSION shRNA shRNA Plasmid DNA
tigger transposable element derived 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198634.1-1813s1c1
Sequence:CCGGCTTAGTCTAAATAGGGTAGAACTCGAGTTCTACCCTATTTAGACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198634.1-537s1c1
Sequence:CCGGCGTCGAAACAATGTGGGCTTTCTCGAGAAAGCCCACATTGTTTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198634.1-536s1c1
Sequence:CCGGACGTCGAAACAATGTGGGCTTCTCGAGAAGCCCACATTGTTTCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198634.1-528s1c1
Sequence:CCGGCGCTGGAAACGTCGAAACAATCTCGAGATTGTTTCGACGTTTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198634.1-729s1c1
Sequence:CCGGGATCGGTTGCAAGTACTGTTACTCGAGTAACAGTACTTGCAACCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198634
TIGD3 MISSION shRNA Lentiviral Transduction Particles
tigger transposable element derived 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198634.1-1813s1c1
Sequence:CCGGCTTAGTCTAAATAGGGTAGAACTCGAGTTCTACCCTATTTAGACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198634.1-537s1c1
Sequence:CCGGCGTCGAAACAATGTGGGCTTTCTCGAGAAAGCCCACATTGTTTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198634.1-536s1c1
Sequence:CCGGACGTCGAAACAATGTGGGCTTCTCGAGAAGCCCACATTGTTTCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198634.1-528s1c1
Sequence:CCGGCGCTGGAAACGTCGAAACAATCTCGAGATTGTTTCGACGTTTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198634.1-729s1c1
Sequence:CCGGGATCGGTTGCAAGTACTGTTACTCGAGTAACAGTACTTGCAACCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks