EMAIL THIS PAGE TO A FRIEND

TIGD4

tigger transposable element derived 4

UniProtKB ID: Q8IY51, Q96LP5
Gene ID:
Human(201798) Summary: The protein encoded by this gene belongs to the tigger subfamily of the pogo superfamily of DNA-mediated transposons in humans. These proteins are related to DNA transposons found in fungi and nematodes, and more distantly to the Tc1 and mariner transposases. They are also very similar to the major mammalian centromere protein B. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
Mouse(403175) tigger transposable element derived 4
Rat(295162) tigger transposable element derived 4
domestic cat(101095894) tigger transposable element derived 4
cow(101907287) tigger transposable element derived 4
cow(538784) tigger transposable element derived 4
sheep(101104180) tigger transposable element derived 4
naked mole-rat(101719239) tigger transposable element derived 4
domestic guinea pig(100717590) tigger transposable element derived 4
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145720 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145720 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145720 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207278 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207278 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207278 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU100851 MISSION® esiRNA esiRNA human TIGD4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145720 Rosetta Predictions human pricing
XM_001072194 Rosetta Predictions rat pricing
XM_227318 Rosetta Predictions rat pricing
NM_207278 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240886 predicted 2100
2 SASI_Hs01_00240887 predicted 1837
3 SASI_Hs01_00240888 predicted 900
4 SASI_Hs01_00240889 predicted 1066
5 SASI_Hs01_00240890 predicted 1348
6 SASI_Hs01_00240891 predicted 1131
7 SASI_Hs01_00240892 predicted 1618
8 SASI_Hs01_00240893 predicted 1353
9 SASI_Hs01_00240894 predicted 1524
10 SASI_Hs01_00240895 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072194 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00338161 predicted 1245
2 SASI_Rn02_00338162 predicted 1103
3 SASI_Rn02_00338163 predicted 399
4 SASI_Rn02_00338164 predicted 490
5 SASI_Rn02_00338165 predicted 1212
6 SASI_Rn02_00338166 predicted 696
7 SASI_Rn02_00338167 predicted 914
8 SASI_Rn02_00338168 predicted 1024
9 SASI_Rn02_00338169 predicted 1273
10 SASI_Rn02_00338170 predicted 1084
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227318 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384237 predicted 1252
2 SASI_Rn02_00384238 predicted 1101
3 SASI_Rn02_00384239 predicted 399
4 SASI_Rn02_00384240 predicted 488
5 SASI_Rn02_00384241 predicted 1213
6 SASI_Rn02_00384242 predicted 690
7 SASI_Rn02_00384243 predicted 911
8 SASI_Rn02_00384244 predicted 1028
9 SASI_Rn02_00384245 predicted 1266
10 SASI_Rn02_00384246 predicted 1089
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207278 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163145 predicted 1250
2 SASI_Mm01_00163146 predicted 921
3 SASI_Mm01_00163147 predicted 1040
4 SASI_Mm01_00163149 predicted 1542
5 SASI_Mm01_00163150 predicted 508
6 SASI_Mm01_00163151 predicted 275
7 SASI_Mm01_00163152 predicted 642
8 SASI_Mm01_00163153 predicted 405
9 SASI_Mm01_00163154 predicted 1653
10 SASI_Mm02_00352040 predicted 801
11 SASI_Mm01_00163148 predicted 703
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145720
TIGD4 MISSION shRNA Bacterial Glycerol Stock
tigger transposable element derived 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145720.2-2169s1c1
Sequence:CCGGCCAGGAACTGAACTCCCTTTACTCGAGTAAAGGGAGTTCAGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145720.2-1224s1c1
Sequence:CCGGCCTGTAGAAGCTACAGGTGTACTCGAGTACACCTGTAGCTTCTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145720.2-1959s1c1
Sequence:CCGGGAGAAGGATACTGGTCTGGATCTCGAGATCCAGACCAGTATCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145720.2-1195s1c1
Sequence:CCGGCCAGGTATGGTTTAGTATTCACTCGAGTGAATACTAAACCATACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145720.2-2250s1c1
Sequence:CCGGGATATGAATGACGGACTTCAACTCGAGTTGAAGTCCGTCATTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145720.2-1567s1c1
Sequence:CCGGCCGATGTATTTGAACAATGGACTCGAGTCCATTGTTCAAATACATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145720.2-1068s1c1
Sequence:CCGGCGAATTGCTCAGTGTCTAAATCTCGAGATTTAGACACTGAGCAATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145720.2-1564s1c1
Sequence:CCGGCCTCCGATGTATTTGAACAATCTCGAGATTGTTCAAATACATCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145720.2-1385s1c1
Sequence:CCGGCGAAACATGTTCAGTTGGAAACTCGAGTTTCCAACTGAACATGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145720.2-1526s1c1
Sequence:CCGGGCCTGTGTGTTATGAAGCTAACTCGAGTTAGCTTCATAACACACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145720.2-1092s1c1
Sequence:CCGGCCAGTTAATGGTCCGATGTTACTCGAGTAACATCGGACCATTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145720
TIGD4 MISSION shRNA shRNA Plasmid DNA
tigger transposable element derived 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145720.2-2169s1c1
Sequence:CCGGCCAGGAACTGAACTCCCTTTACTCGAGTAAAGGGAGTTCAGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145720.2-1224s1c1
Sequence:CCGGCCTGTAGAAGCTACAGGTGTACTCGAGTACACCTGTAGCTTCTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145720.2-1959s1c1
Sequence:CCGGGAGAAGGATACTGGTCTGGATCTCGAGATCCAGACCAGTATCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145720.2-1195s1c1
Sequence:CCGGCCAGGTATGGTTTAGTATTCACTCGAGTGAATACTAAACCATACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145720.2-2250s1c1
Sequence:CCGGGATATGAATGACGGACTTCAACTCGAGTTGAAGTCCGTCATTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145720.2-1567s1c1
Sequence:CCGGCCGATGTATTTGAACAATGGACTCGAGTCCATTGTTCAAATACATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145720.2-1068s1c1
Sequence:CCGGCGAATTGCTCAGTGTCTAAATCTCGAGATTTAGACACTGAGCAATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145720.2-1564s1c1
Sequence:CCGGCCTCCGATGTATTTGAACAATCTCGAGATTGTTCAAATACATCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145720.2-1385s1c1
Sequence:CCGGCGAAACATGTTCAGTTGGAAACTCGAGTTTCCAACTGAACATGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145720.2-1526s1c1
Sequence:CCGGGCCTGTGTGTTATGAAGCTAACTCGAGTTAGCTTCATAACACACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145720.2-1092s1c1
Sequence:CCGGCCAGTTAATGGTCCGATGTTACTCGAGTAACATCGGACCATTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145720
TIGD4 MISSION shRNA Lentiviral Transduction Particles
tigger transposable element derived 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145720.2-2169s1c1
Sequence:CCGGCCAGGAACTGAACTCCCTTTACTCGAGTAAAGGGAGTTCAGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145720.2-1224s1c1
Sequence:CCGGCCTGTAGAAGCTACAGGTGTACTCGAGTACACCTGTAGCTTCTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145720.2-1959s1c1
Sequence:CCGGGAGAAGGATACTGGTCTGGATCTCGAGATCCAGACCAGTATCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145720.2-1195s1c1
Sequence:CCGGCCAGGTATGGTTTAGTATTCACTCGAGTGAATACTAAACCATACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145720.2-2250s1c1
Sequence:CCGGGATATGAATGACGGACTTCAACTCGAGTTGAAGTCCGTCATTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145720.2-1567s1c1
Sequence:CCGGCCGATGTATTTGAACAATGGACTCGAGTCCATTGTTCAAATACATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145720.2-1068s1c1
Sequence:CCGGCGAATTGCTCAGTGTCTAAATCTCGAGATTTAGACACTGAGCAATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145720.2-1564s1c1
Sequence:CCGGCCTCCGATGTATTTGAACAATCTCGAGATTGTTCAAATACATCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145720.2-1385s1c1
Sequence:CCGGCGAAACATGTTCAGTTGGAAACTCGAGTTTCCAACTGAACATGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145720.2-1526s1c1
Sequence:CCGGGCCTGTGTGTTATGAAGCTAACTCGAGTTAGCTTCATAACACACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145720.2-1092s1c1
Sequence:CCGGCCAGTTAATGGTCCGATGTTACTCGAGTAACATCGGACCATTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207278
TIGD4 MISSION shRNA Bacterial Glycerol Stock
tigger transposable element derived 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207278.1-1155s1c1
Sequence:CCGGGCTATGAATCAAGGTGTTATTCTCGAGAATAACACCTTGATTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207278.1-1686s1c1
Sequence:CCGGGATGAACTTCACGGTTCTTTACTCGAGTAAAGAACCGTGAAGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207278.2-647s21c1
Sequence:CCGGCCGTAGAAGCCACGGGTATATCTCGAGATATACCCGTGGCTTCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207278.2-1736s1c1
Sequence:CCGGCACCTAAGTAGTCACGTATTGCTCGAGCAATACGTGACTACTTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207278.2-1154s21c1
Sequence:CCGGCTATGAATCAAGGTGTTATTACTCGAGTAATAACACCTTGATTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207278.2-2330s21c1
Sequence:CCGGTGAGCATCATAGTAGTATAAACTCGAGTTTATACTACTATGATGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207278.2-769s21c1
Sequence:CCGGTATCGAATGTTACCTACAAATCTCGAGATTTGTAGGTAACATTCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207278.2-522s21c1
Sequence:CCGGTGGCCCGATGTTGCGTCTAAACTCGAGTTTAGACGCAACATCGGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207278
TIGD4 MISSION shRNA shRNA Plasmid DNA
tigger transposable element derived 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207278.1-1155s1c1
Sequence:CCGGGCTATGAATCAAGGTGTTATTCTCGAGAATAACACCTTGATTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207278.1-1686s1c1
Sequence:CCGGGATGAACTTCACGGTTCTTTACTCGAGTAAAGAACCGTGAAGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207278.2-647s21c1
Sequence:CCGGCCGTAGAAGCCACGGGTATATCTCGAGATATACCCGTGGCTTCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207278.2-1736s1c1
Sequence:CCGGCACCTAAGTAGTCACGTATTGCTCGAGCAATACGTGACTACTTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207278.2-1154s21c1
Sequence:CCGGCTATGAATCAAGGTGTTATTACTCGAGTAATAACACCTTGATTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207278.2-2330s21c1
Sequence:CCGGTGAGCATCATAGTAGTATAAACTCGAGTTTATACTACTATGATGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207278.2-769s21c1
Sequence:CCGGTATCGAATGTTACCTACAAATCTCGAGATTTGTAGGTAACATTCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207278.2-522s21c1
Sequence:CCGGTGGCCCGATGTTGCGTCTAAACTCGAGTTTAGACGCAACATCGGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207278
TIGD4 MISSION shRNA Lentiviral Transduction Particles
tigger transposable element derived 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207278.1-1155s1c1
Sequence:CCGGGCTATGAATCAAGGTGTTATTCTCGAGAATAACACCTTGATTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207278.1-1686s1c1
Sequence:CCGGGATGAACTTCACGGTTCTTTACTCGAGTAAAGAACCGTGAAGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207278.2-647s21c1
Sequence:CCGGCCGTAGAAGCCACGGGTATATCTCGAGATATACCCGTGGCTTCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207278.2-1736s1c1
Sequence:CCGGCACCTAAGTAGTCACGTATTGCTCGAGCAATACGTGACTACTTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207278.2-1154s21c1
Sequence:CCGGCTATGAATCAAGGTGTTATTACTCGAGTAATAACACCTTGATTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207278.2-2330s21c1
Sequence:CCGGTGAGCATCATAGTAGTATAAACTCGAGTTTATACTACTATGATGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207278.2-769s21c1
Sequence:CCGGTATCGAATGTTACCTACAAATCTCGAGATTTGTAGGTAACATTCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207278.2-522s21c1
Sequence:CCGGTGGCCCGATGTTGCGTCTAAACTCGAGTTTAGACGCAACATCGGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks