EMAIL THIS PAGE TO A FRIEND

TIGD5

tigger transposable element derived 5

UniProtKB ID: Q53EQ6, E7EWS2, Q6NT83, Q8N5A1, Q96JW8
Gene ID:
Human(84948) Summary: The protein encoded by this gene belongs to the tigger subfamily of the pogo superfamily of DNA-mediated transposons in humans. These proteins are related to DNA transposons found in fungi and nematodes, and more distantly to the Tc1 and mariner transposases. They are also very similar to the major mammalian centromere protein B. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
Mouse(105734) tigger transposable element derived 5
Rat(300034) tigger transposable element derived 5
naked mole-rat(101719879) tigger transposable element derived 5
cow(101903505) tigger transposable element derived 5
cow(540422) tigger transposable element derived 5
sheep(101113248) tigger transposable element derived 5
chicken(428380) tigger transposable element derived 5
chicken(101668919) tigger transposable element derived 5
chicken(101749031) tigger transposable element derived 5
domestic cat(101090236) tigger transposable element derived 5
41 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301692 Anti-TIGD5 affinity isolated antibody human
immunohistochemistry pricing
SAB1301452 ANTI-TIGD5 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178646 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178646 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178646 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032862 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032862 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032862 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032862 Rosetta Predictions human pricing
NM_001126268 Rosetta Predictions rat pricing
NM_178646 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208534 predicted 1695
2 SASI_Hs02_00360463 predicted 1198
3 SASI_Hs01_00208535 predicted 1190
4 SASI_Hs01_00208536 predicted 1119
5 SASI_Hs01_00208537 predicted 1832
6 SASI_Hs01_00208539 predicted 2004
7 SASI_Hs01_00208540 predicted 1578
8 SASI_Hs01_00208541 predicted 1584
9 SASI_Hs01_00208542 predicted 1682
10 SASI_Hs01_00208543 predicted 1344
11 SASI_Hs01_00208538 predicted 1538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126268 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253053 predicted 851
2 SASI_Rn02_00253054 predicted 303
3 SASI_Rn02_00253055 predicted 844
4 SASI_Rn02_00253056 predicted 438
5 SASI_Rn02_00253057 predicted 1190
6 SASI_Rn02_00253058 predicted 1432
7 SASI_Rn02_00253059 predicted 546
8 SASI_Rn02_00253060 predicted 1643
9 SASI_Rn02_00253061 predicted 1156
10 SASI_Rn02_00253062 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178646 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110957 predicted 774
2 SASI_Mm01_00110958 predicted 889
3 SASI_Mm01_00110959 predicted 1978
4 SASI_Mm01_00110960 predicted 504
5 SASI_Mm01_00110961 predicted 1276
6 SASI_Mm01_00110962 predicted 1115
7 SASI_Mm01_00110963 predicted 1074
8 SASI_Mm01_00110964 predicted 465
9 SASI_Mm01_00110965 predicted 636
10 SASI_Mm02_00349056 predicted 1352
11 SASI_Mm01_00110966 predicted 424
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178646
TIGD5 MISSION shRNA Bacterial Glycerol Stock
tigger transposable element derived 5
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178646.3-793s21c1
Sequence:CCGGCTAACGTTACTGGTCTCTATTCTCGAGAATAGAGACCAGTAACGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178646.3-1427s1c1
Sequence:CCGGCATGAGAAGCTTCGTTCTCAACTCGAGTTGAGAACGAAGCTTCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178646.3-2190s21c1
Sequence:CCGGAGGCACATGTGGGCACATAAGCTCGAGCTTATGTGCCCACATGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178646.3-628s21c1
Sequence:CCGGTCTCTAGCCAGCGCATCTATGCTCGAGCATAGATGCGCTGGCTAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178646.3-240s21c1
Sequence:CCGGTTCCGCAAGGCCTACTCAATCCTCGAGGATTGAGTAGGCCTTGCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178646.3-1068s21c1
Sequence:CCGGGGCTGGTTCTTCGAGGAATTTCTCGAGAAATTCCTCGAAGAACCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178646.2-1881s1c1
Sequence:CCGGGCTACGTTCTCTCATTACCATCTCGAGATGGTAATGAGAGAACGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178646.2-1248s1c1
Sequence:CCGGGCAGTTCGAGTGCTCTTCTTACTCGAGTAAGAAGAGCACTCGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178646.2-216s1c1
Sequence:CCGGCGCAAGGCCTACTCAATCAAACTCGAGTTTGATTGAGTAGGCCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178646.2-1233s1c1
Sequence:CCGGCAAACACCTGATGGTGCAGTTCTCGAGAACTGCACCATCAGGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178646.2-765s1c1
Sequence:CCGGGCTAACGTTACTGGTCTCTATCTCGAGATAGAGACCAGTAACGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193821    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178646.2-3677s1c1
Sequence:CCGGCCAGGAGATTATGACCTCATACTCGAGTATGAGGTCATAATCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178646.2-914s1c1
Sequence:CCGGCAAGCTGAAACCACTAGTCATCTCGAGATGACTAGTGGTTTCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178646
TIGD5 MISSION shRNA shRNA Plasmid DNA
tigger transposable element derived 5
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178646.3-793s21c1
Sequence:CCGGCTAACGTTACTGGTCTCTATTCTCGAGAATAGAGACCAGTAACGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178646.3-1427s1c1
Sequence:CCGGCATGAGAAGCTTCGTTCTCAACTCGAGTTGAGAACGAAGCTTCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178646.3-2190s21c1
Sequence:CCGGAGGCACATGTGGGCACATAAGCTCGAGCTTATGTGCCCACATGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178646.3-628s21c1
Sequence:CCGGTCTCTAGCCAGCGCATCTATGCTCGAGCATAGATGCGCTGGCTAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178646.3-240s21c1
Sequence:CCGGTTCCGCAAGGCCTACTCAATCCTCGAGGATTGAGTAGGCCTTGCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178646.3-1068s21c1
Sequence:CCGGGGCTGGTTCTTCGAGGAATTTCTCGAGAAATTCCTCGAAGAACCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178646.2-1881s1c1
Sequence:CCGGGCTACGTTCTCTCATTACCATCTCGAGATGGTAATGAGAGAACGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178646.2-1248s1c1
Sequence:CCGGGCAGTTCGAGTGCTCTTCTTACTCGAGTAAGAAGAGCACTCGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178646.2-216s1c1
Sequence:CCGGCGCAAGGCCTACTCAATCAAACTCGAGTTTGATTGAGTAGGCCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178646.2-1233s1c1
Sequence:CCGGCAAACACCTGATGGTGCAGTTCTCGAGAACTGCACCATCAGGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178646.2-765s1c1
Sequence:CCGGGCTAACGTTACTGGTCTCTATCTCGAGATAGAGACCAGTAACGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193821    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178646.2-3677s1c1
Sequence:CCGGCCAGGAGATTATGACCTCATACTCGAGTATGAGGTCATAATCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178646.2-914s1c1
Sequence:CCGGCAAGCTGAAACCACTAGTCATCTCGAGATGACTAGTGGTTTCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178646
TIGD5 MISSION shRNA Lentiviral Transduction Particles
tigger transposable element derived 5
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178646.3-793s21c1
Sequence:CCGGCTAACGTTACTGGTCTCTATTCTCGAGAATAGAGACCAGTAACGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178646.3-1427s1c1
Sequence:CCGGCATGAGAAGCTTCGTTCTCAACTCGAGTTGAGAACGAAGCTTCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178646.3-2190s21c1
Sequence:CCGGAGGCACATGTGGGCACATAAGCTCGAGCTTATGTGCCCACATGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178646.3-628s21c1
Sequence:CCGGTCTCTAGCCAGCGCATCTATGCTCGAGCATAGATGCGCTGGCTAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178646.3-240s21c1
Sequence:CCGGTTCCGCAAGGCCTACTCAATCCTCGAGGATTGAGTAGGCCTTGCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178646.3-1068s21c1
Sequence:CCGGGGCTGGTTCTTCGAGGAATTTCTCGAGAAATTCCTCGAAGAACCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178646.2-1881s1c1
Sequence:CCGGGCTACGTTCTCTCATTACCATCTCGAGATGGTAATGAGAGAACGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178646.2-1248s1c1
Sequence:CCGGGCAGTTCGAGTGCTCTTCTTACTCGAGTAAGAAGAGCACTCGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178646.2-216s1c1
Sequence:CCGGCGCAAGGCCTACTCAATCAAACTCGAGTTTGATTGAGTAGGCCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178646.2-1233s1c1
Sequence:CCGGCAAACACCTGATGGTGCAGTTCTCGAGAACTGCACCATCAGGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178646.2-765s1c1
Sequence:CCGGGCTAACGTTACTGGTCTCTATCTCGAGATAGAGACCAGTAACGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193821    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178646.2-3677s1c1
Sequence:CCGGCCAGGAGATTATGACCTCATACTCGAGTATGAGGTCATAATCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178646.2-914s1c1
Sequence:CCGGCAAGCTGAAACCACTAGTCATCTCGAGATGACTAGTGGTTTCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032862
TIGD5 MISSION shRNA Bacterial Glycerol Stock
tigger transposable element derived 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032862.3-1700s21c1
Sequence:CCGGTGCAGTTGCGCTCACTCATCACTCGAGTGATGAGTGAGCGCAACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032862.3-842s21c1
Sequence:CCGGGCTGGTTCTTTGAGGAATTTGCTCGAGCAAATTCCTCAAAGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032862.3-1198s21c1
Sequence:CCGGATGCGCAGCTTCATGCTCAAGCTCGAGCTTGAGCATGAAGCTGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032862.3-1121s21c1
Sequence:CCGGCCGCCTTCAAACAGCTGTACACTCGAGTGTACAGCTGTTTGAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032862.3-2034s21c1
Sequence:CCGGATACAAGGCACAGCGCCTGTTCTCGAGAACAGGCGCTGTGCCTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032862.2-1203s1c1
Sequence:CCGGCAGCTTCATGCTCAAGGACATCTCGAGATGTCCTTGAGCATGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032862.2-856s1c1
Sequence:CCGGGAATTTGTCCCAGGCGTCAAACTCGAGTTTGACGCCTGGGACAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032862
TIGD5 MISSION shRNA shRNA Plasmid DNA
tigger transposable element derived 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032862.3-1700s21c1
Sequence:CCGGTGCAGTTGCGCTCACTCATCACTCGAGTGATGAGTGAGCGCAACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032862.3-842s21c1
Sequence:CCGGGCTGGTTCTTTGAGGAATTTGCTCGAGCAAATTCCTCAAAGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032862.3-1198s21c1
Sequence:CCGGATGCGCAGCTTCATGCTCAAGCTCGAGCTTGAGCATGAAGCTGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032862.3-1121s21c1
Sequence:CCGGCCGCCTTCAAACAGCTGTACACTCGAGTGTACAGCTGTTTGAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032862.3-2034s21c1
Sequence:CCGGATACAAGGCACAGCGCCTGTTCTCGAGAACAGGCGCTGTGCCTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032862.2-1203s1c1
Sequence:CCGGCAGCTTCATGCTCAAGGACATCTCGAGATGTCCTTGAGCATGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032862.2-856s1c1
Sequence:CCGGGAATTTGTCCCAGGCGTCAAACTCGAGTTTGACGCCTGGGACAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032862
TIGD5 MISSION shRNA Lentiviral Transduction Particles
tigger transposable element derived 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032862.3-1700s21c1
Sequence:CCGGTGCAGTTGCGCTCACTCATCACTCGAGTGATGAGTGAGCGCAACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032862.3-842s21c1
Sequence:CCGGGCTGGTTCTTTGAGGAATTTGCTCGAGCAAATTCCTCAAAGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032862.3-1198s21c1
Sequence:CCGGATGCGCAGCTTCATGCTCAAGCTCGAGCTTGAGCATGAAGCTGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032862.3-1121s21c1
Sequence:CCGGCCGCCTTCAAACAGCTGTACACTCGAGTGTACAGCTGTTTGAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032862.3-2034s21c1
Sequence:CCGGATACAAGGCACAGCGCCTGTTCTCGAGAACAGGCGCTGTGCCTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032862.2-1203s1c1
Sequence:CCGGCAGCTTCATGCTCAAGGACATCTCGAGATGTCCTTGAGCATGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032862.2-856s1c1
Sequence:CCGGGAATTTGTCCCAGGCGTCAAACTCGAGTTTGACGCCTGGGACAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks