EMAIL THIS PAGE TO A FRIEND

TIGD6

tigger transposable element derived 6

UniProtKB ID: Q17RP2, B3KTZ8, Q96MQ4, Q9H0X7
Gene ID:
Human(81789) Summary: The protein encoded by this gene belongs to the tigger subfamily of the pogo superfamily of DNA-mediated transposons in humans. These proteins are related to DNA transposons found in fungi and nematodes, and more distantly to the Tc1 and mariner transposases. They are also very similar to the major mammalian centromere protein B. [provided by RefSeq, Oct 2009]
domestic cat(101084854) tigger transposable element derived 6
sheep(101122275) tigger transposable element derived 6
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030953 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030953 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030953 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027561 MISSION® esiRNA esiRNA human TIGD6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030953 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030953 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021490 predicted 1222
2 SASI_Hs01_00021491 predicted 367
3 SASI_Hs01_00021492 predicted 586
4 SASI_Hs01_00021493 predicted 1773
5 SASI_Hs01_00021495 predicted 760
6 SASI_Hs01_00021496 predicted 1026
7 SASI_Hs01_00021498 predicted 537
8 SASI_Hs01_00021499 predicted 1513
9 SASI_Hs02_00358533 predicted 697
10 SASI_Hs02_00358534 predicted 1108
11 SASI_Hs01_00021494 predicted 1672
12 SASI_Hs01_00021497 predicted 390
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030953
TIGD6 MISSION shRNA Bacterial Glycerol Stock
tigger transposable element derived 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030953.2-3299s1c1
Sequence:CCGGCCCATAGCAATTCAGTGATTTCTCGAGAAATCACTGAATTGCTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030953.2-1198s1c1
Sequence:CCGGGCCACTGAATCTTGGCATAATCTCGAGATTATGCCAAGATTCAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030953.2-1656s1c1
Sequence:CCGGCCATCACAGAAGCCATATCAACTCGAGTTGATATGGCTTCTGTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030953.2-488s1c1
Sequence:CCGGGATGACATTGATAAGGCTGTTCTCGAGAACAGCCTTATCAATGTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030953.2-650s1c1
Sequence:CCGGCGCCACGGAATTGCTTTGAAACTCGAGTTTCAAAGCAATTCCGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030953.2-683s21c1
Sequence:CCGGGAAGATAGTGACAGGTTAATGCTCGAGCATTAACCTGTCACTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030953.2-1773s21c1
Sequence:CCGGGAGTGACACAAACCCTTATTGCTCGAGCAATAAGGGTTTGTGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030953.2-1882s21c1
Sequence:CCGGTAGGTTGTTGAGCCAATTTAACTCGAGTTAAATTGGCTCAACAACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030953.2-375s21c1
Sequence:CCGGGTATCACTCCCTCTACTTTATCTCGAGATAAAGTAGAGGGAGTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030953
TIGD6 MISSION shRNA shRNA Plasmid DNA
tigger transposable element derived 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030953.2-3299s1c1
Sequence:CCGGCCCATAGCAATTCAGTGATTTCTCGAGAAATCACTGAATTGCTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030953.2-1198s1c1
Sequence:CCGGGCCACTGAATCTTGGCATAATCTCGAGATTATGCCAAGATTCAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030953.2-1656s1c1
Sequence:CCGGCCATCACAGAAGCCATATCAACTCGAGTTGATATGGCTTCTGTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030953.2-488s1c1
Sequence:CCGGGATGACATTGATAAGGCTGTTCTCGAGAACAGCCTTATCAATGTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030953.2-650s1c1
Sequence:CCGGCGCCACGGAATTGCTTTGAAACTCGAGTTTCAAAGCAATTCCGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030953.2-683s21c1
Sequence:CCGGGAAGATAGTGACAGGTTAATGCTCGAGCATTAACCTGTCACTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030953.2-1773s21c1
Sequence:CCGGGAGTGACACAAACCCTTATTGCTCGAGCAATAAGGGTTTGTGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030953.2-1882s21c1
Sequence:CCGGTAGGTTGTTGAGCCAATTTAACTCGAGTTAAATTGGCTCAACAACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030953.2-375s21c1
Sequence:CCGGGTATCACTCCCTCTACTTTATCTCGAGATAAAGTAGAGGGAGTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030953
TIGD6 MISSION shRNA Lentiviral Transduction Particles
tigger transposable element derived 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030953.2-3299s1c1
Sequence:CCGGCCCATAGCAATTCAGTGATTTCTCGAGAAATCACTGAATTGCTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030953.2-1198s1c1
Sequence:CCGGGCCACTGAATCTTGGCATAATCTCGAGATTATGCCAAGATTCAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030953.2-1656s1c1
Sequence:CCGGCCATCACAGAAGCCATATCAACTCGAGTTGATATGGCTTCTGTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030953.2-488s1c1
Sequence:CCGGGATGACATTGATAAGGCTGTTCTCGAGAACAGCCTTATCAATGTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030953.2-650s1c1
Sequence:CCGGCGCCACGGAATTGCTTTGAAACTCGAGTTTCAAAGCAATTCCGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030953.2-683s21c1
Sequence:CCGGGAAGATAGTGACAGGTTAATGCTCGAGCATTAACCTGTCACTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030953.2-1773s21c1
Sequence:CCGGGAGTGACACAAACCCTTATTGCTCGAGCAATAAGGGTTTGTGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030953.2-1882s21c1
Sequence:CCGGTAGGTTGTTGAGCCAATTTAACTCGAGTTAAATTGGCTCAACAACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030953.2-375s21c1
Sequence:CCGGGTATCACTCCCTCTACTTTATCTCGAGATAAAGTAGAGGGAGTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks