EMAIL THIS PAGE TO A FRIEND

TIGD7

tigger transposable element derived 7

Synonyms: Sancho
UniProtKB ID: Q6NT04, Q9BXZ0
Gene ID:
Human(91151) Summary: The protein encoded by this gene belongs to the tigger subfamily of the pogo superfamily of DNA-mediated transposons in humans. These proteins are related to DNA transposons found in fungi and nematodes, and more distantly to the Tc1 and mariner transposases. They are also very similar to the major mammalian centromere protein B. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
cow(101903519) tigger transposable element derived 7
sheep(101120540) tigger transposable element derived 7
cow(100141053) tigger transposable element derived 7
dog(100683507) tigger transposable element derived 7
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033208 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033208 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033208 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026151 MISSION® esiRNA esiRNA human TIGD7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033208 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033208 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360997 predicted 1505
2 SASI_Hs02_00360998 predicted 1218
3 SASI_Hs02_00360999 predicted 1178
4 SASI_Hs02_00361000 predicted 1435
5 SASI_Hs02_00361001 predicted 2086
6 SASI_Hs02_00361002 predicted 2224
7 SASI_Hs01_00167373 predicted 2316
8 SASI_Hs02_00361003 predicted 1438
9 SASI_Hs02_00361004 predicted 1130
10 SASI_Hs02_00361005 predicted 2066
11 SASI_Hs01_00167374 predicted 2289
12 SASI_Hs01_00167375 predicted 2319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033208
TIGD7 MISSION shRNA Bacterial Glycerol Stock
tigger transposable element derived 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033208.2-1596s21c1
Sequence:CCGGTGTTCCTGAGGTCCGACATTTCTCGAGAAATGTCGGACCTCAGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033208.2-1800s1c1
Sequence:CCGGCAAACGGCTGTATAGATGGAACTCGAGTTCCATCTATACAGCCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033208.2-845s1c1
Sequence:CCGGGTAGAATTGAAGCTGGACGATCTCGAGATCGTCCAGCTTCAATTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033208.2-1657s1c1
Sequence:CCGGGCATTGTTACTTCTGGACAGTCTCGAGACTGTCCAGAAGTAACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033208.2-1967s1c1
Sequence:CCGGCCATAGCAAATGCATGGGAAACTCGAGTTTCCCATGCATTTGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033208.2-1509s1c1
Sequence:CCGGCACAAGTACATTGCCTGTGATCTCGAGATCACAGGCAATGTACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033208.2-1106s1c1
Sequence:CCGGCAGAGAGATTTGCACGGTGTTCTCGAGAACACCGTGCAAATCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033208.2-1432s1c1
Sequence:CCGGGCAAATGCAGACGGAACTCATCTCGAGATGAGTTCCGTCTGCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033208
TIGD7 MISSION shRNA shRNA Plasmid DNA
tigger transposable element derived 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033208.2-1596s21c1
Sequence:CCGGTGTTCCTGAGGTCCGACATTTCTCGAGAAATGTCGGACCTCAGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033208.2-1800s1c1
Sequence:CCGGCAAACGGCTGTATAGATGGAACTCGAGTTCCATCTATACAGCCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033208.2-845s1c1
Sequence:CCGGGTAGAATTGAAGCTGGACGATCTCGAGATCGTCCAGCTTCAATTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033208.2-1657s1c1
Sequence:CCGGGCATTGTTACTTCTGGACAGTCTCGAGACTGTCCAGAAGTAACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033208.2-1967s1c1
Sequence:CCGGCCATAGCAAATGCATGGGAAACTCGAGTTTCCCATGCATTTGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033208.2-1509s1c1
Sequence:CCGGCACAAGTACATTGCCTGTGATCTCGAGATCACAGGCAATGTACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033208.2-1106s1c1
Sequence:CCGGCAGAGAGATTTGCACGGTGTTCTCGAGAACACCGTGCAAATCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033208.2-1432s1c1
Sequence:CCGGGCAAATGCAGACGGAACTCATCTCGAGATGAGTTCCGTCTGCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033208
TIGD7 MISSION shRNA Lentiviral Transduction Particles
tigger transposable element derived 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033208.2-1596s21c1
Sequence:CCGGTGTTCCTGAGGTCCGACATTTCTCGAGAAATGTCGGACCTCAGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033208.2-1800s1c1
Sequence:CCGGCAAACGGCTGTATAGATGGAACTCGAGTTCCATCTATACAGCCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033208.2-845s1c1
Sequence:CCGGGTAGAATTGAAGCTGGACGATCTCGAGATCGTCCAGCTTCAATTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033208.2-1657s1c1
Sequence:CCGGGCATTGTTACTTCTGGACAGTCTCGAGACTGTCCAGAAGTAACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033208.2-1967s1c1
Sequence:CCGGCCATAGCAAATGCATGGGAAACTCGAGTTTCCCATGCATTTGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033208.2-1509s1c1
Sequence:CCGGCACAAGTACATTGCCTGTGATCTCGAGATCACAGGCAATGTACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033208.2-1106s1c1
Sequence:CCGGCAGAGAGATTTGCACGGTGTTCTCGAGAACACCGTGCAAATCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033208.2-1432s1c1
Sequence:CCGGGCAAATGCAGACGGAACTCATCTCGAGATGAGTTCCGTCTGCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks