EMAIL THIS PAGE TO A FRIEND

TIGIT

T cell immunoreceptor with Ig and ITIM domains

Synonyms: VSIG9 VSTM3 WUCAM
UniProtKB ID: Q495A1, Q495A3, Q5JPD8, Q6MZS2, Q8N877
Gene ID:
Human(201633) Summary: This gene encodes a member of the PVR (poliovirus receptor) family of immunoglobin proteins. The product of this gene is expressed on several classes of T cells including follicular B helper T cells (TFH). The protein has been shown to bind PVR with high affinity; this binding is thought to assist interactions between TFH and dendritic cells to regulate T cell dependent B cell responses.[provided by RefSeq, Sep 2009]
Mouse(100043314) T cell immunoreceptor with Ig and ITIM domains
Rat(363784) T cell immunoreceptor with Ig and ITIM domains
dog(487986) T cell immunoreceptor with Ig and ITIM domains
domestic cat(101098326) T cell immunoreceptor with Ig and ITIM domains
cow(100140801) T cell immunoreceptor with Ig and ITIM domains
sheep(101116533) T cell immunoreceptor with Ig and ITIM domains
naked mole-rat(101713509) T cell immunoreceptor with Ig and ITIM domains
domestic guinea pig(100716636) T cell immunoreceptor with Ig and ITIM domains
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173799 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173799 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173799 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001146325 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001146325 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001146325 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU175571 MISSION® esiRNA esiRNA targeting mouse Tigit mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173799 Rosetta Predictions human pricing
XM_001067871 Rosetta Predictions rat pricing
XM_344021 Rosetta Predictions rat pricing
XM_001479949 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173799 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240866 predicted 299
2 SASI_Hs01_00240868 predicted 381
3 SASI_Hs01_00240867 predicted 440
4 SASI_Hs01_00240869 predicted 1189
5 SASI_Hs01_00240871 predicted 801
6 SASI_Hs01_00240872 predicted 798
7 SASI_Hs01_00240873 predicted 807
8 SASI_Hs02_00368653 predicted 741
9 SASI_Hs01_00240874 predicted 1205
10 SASI_Hs01_00240875 predicted 979
11 SASI_Hs01_00240870 predicted 1089
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067871 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00322669 predicted 216
2 SASI_Rn02_00322670 predicted 404
3 SASI_Rn02_00322671 predicted 381
4 SASI_Rn02_00322672 predicted 297
5 SASI_Rn02_00322673 predicted 307
6 SASI_Rn02_00322674 predicted 355
7 SASI_Rn02_00322675 predicted 281
8 SASI_Rn02_00322676 predicted 398
9 SASI_Rn02_00322677 predicted 228
10 SASI_Rn02_00322678 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344021 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396694 predicted 210
2 SASI_Rn02_00396695 predicted 410
3 SASI_Rn02_00396696 predicted 388
4 SASI_Rn02_00396697 predicted 300
5 SASI_Rn02_00396698 predicted 308
6 SASI_Rn02_00396699 predicted 360
7 SASI_Rn02_00396700 predicted 276
8 SASI_Rn02_00396701 predicted 394
9 SASI_Rn02_00396702 predicted 232
10 SASI_Rn02_00396703 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479949 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00413889 predicted 408
2 SASI_Mm02_00413890 predicted 549
3 SASI_Mm02_00413891 predicted 601
4 SASI_Mm02_00413892 predicted 466
5 SASI_Mm02_00413893 predicted 433
6 SASI_Mm02_00413894 predicted 408
7 SASI_Mm02_00413895 predicted 321
8 SASI_Mm02_00413896 predicted 392
9 SASI_Mm02_00413897 predicted 583
10 SASI_Mm02_00413898 predicted 551
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173799
TIGIT MISSION shRNA Bacterial Glycerol Stock
T cell immunoreceptor with Ig and ITIM domains
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173799.2-451s1c1
Sequence:CCGGGATTCCATTGCTTGGAGCCATCTCGAGATGGCTCCAAGCAATGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179540    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173799.2-1594s1c1
Sequence:CCGGGCTGTGACATACTCATCCATTCTCGAGAATGGATGAGTATGTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147025    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173799.2-1276s1c1
Sequence:CCGGCCCTCAAGAACTTACAGTTAACTCGAGTTAACTGTAAGTTCTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173799.2-984s21c1
Sequence:CCGGTAACGTGGATCTTGATCATAACTCGAGTTATGATCAAGATCCACGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173799.2-323s21c1
Sequence:CCGGTCGCTGACCGTGAACGATACACTCGAGTGTATCGTTCACGGTCAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173799.2-95s21c1
Sequence:CCGGGGAATGATGACAGGCACAATACTCGAGTATTGTGCCTGTCATCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173799.2-696s21c1
Sequence:CCGGAGCTGCATGACTACTTCAATGCTCGAGCATTGAAGTAGTCATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173799.2-345s21c1
Sequence:CCGGGGGAGTACTTCTGCATCTATCCTCGAGGATAGATGCAGAAGTACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173799
TIGIT MISSION shRNA shRNA Plasmid DNA
T cell immunoreceptor with Ig and ITIM domains
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173799.2-451s1c1
Sequence:CCGGGATTCCATTGCTTGGAGCCATCTCGAGATGGCTCCAAGCAATGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179540    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173799.2-1594s1c1
Sequence:CCGGGCTGTGACATACTCATCCATTCTCGAGAATGGATGAGTATGTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147025    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173799.2-1276s1c1
Sequence:CCGGCCCTCAAGAACTTACAGTTAACTCGAGTTAACTGTAAGTTCTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173799.2-984s21c1
Sequence:CCGGTAACGTGGATCTTGATCATAACTCGAGTTATGATCAAGATCCACGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173799.2-323s21c1
Sequence:CCGGTCGCTGACCGTGAACGATACACTCGAGTGTATCGTTCACGGTCAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173799.2-95s21c1
Sequence:CCGGGGAATGATGACAGGCACAATACTCGAGTATTGTGCCTGTCATCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173799.2-696s21c1
Sequence:CCGGAGCTGCATGACTACTTCAATGCTCGAGCATTGAAGTAGTCATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173799.2-345s21c1
Sequence:CCGGGGGAGTACTTCTGCATCTATCCTCGAGGATAGATGCAGAAGTACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173799
TIGIT MISSION shRNA Lentiviral Transduction Particles
T cell immunoreceptor with Ig and ITIM domains
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173799.2-451s1c1
Sequence:CCGGGATTCCATTGCTTGGAGCCATCTCGAGATGGCTCCAAGCAATGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179540    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173799.2-1594s1c1
Sequence:CCGGGCTGTGACATACTCATCCATTCTCGAGAATGGATGAGTATGTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147025    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173799.2-1276s1c1
Sequence:CCGGCCCTCAAGAACTTACAGTTAACTCGAGTTAACTGTAAGTTCTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173799.2-984s21c1
Sequence:CCGGTAACGTGGATCTTGATCATAACTCGAGTTATGATCAAGATCCACGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173799.2-323s21c1
Sequence:CCGGTCGCTGACCGTGAACGATACACTCGAGTGTATCGTTCACGGTCAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173799.2-95s21c1
Sequence:CCGGGGAATGATGACAGGCACAATACTCGAGTATTGTGCCTGTCATCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173799.2-696s21c1
Sequence:CCGGAGCTGCATGACTACTTCAATGCTCGAGCATTGAAGTAGTCATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173799.2-345s21c1
Sequence:CCGGGGGAGTACTTCTGCATCTATCCTCGAGGATAGATGCAGAAGTACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001146325
TIGIT MISSION shRNA Bacterial Glycerol Stock
T cell immunoreceptor with Ig and ITIM domains
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146325.1-287s21c1
Sequence:CCGGGACCAGCTTCTGGCCATTTATCTCGAGATAAATGGCCAGAAGCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146325.1-170s21c1
Sequence:CCGGGCAGGCACGATAGATACAAAGCTCGAGCTTTGTATCTATCGTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146325.1-748s21c1
Sequence:CCGGTGACCCACAGGAATACTTTAACTCGAGTTAAAGTATTCCTGTGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146325.1-415s21c1
Sequence:CCGGGTACTTCTGTACCTATCATACCTCGAGGTATGATAGGTACAGAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146325.1-580s21c1
Sequence:CCGGGGCTAGAAAGAAGTCTATTAGCTCGAGCTAATAGACTTCTTTCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001146325
TIGIT MISSION shRNA shRNA Plasmid DNA
T cell immunoreceptor with Ig and ITIM domains
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146325.1-287s21c1
Sequence:CCGGGACCAGCTTCTGGCCATTTATCTCGAGATAAATGGCCAGAAGCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146325.1-170s21c1
Sequence:CCGGGCAGGCACGATAGATACAAAGCTCGAGCTTTGTATCTATCGTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146325.1-748s21c1
Sequence:CCGGTGACCCACAGGAATACTTTAACTCGAGTTAAAGTATTCCTGTGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146325.1-415s21c1
Sequence:CCGGGTACTTCTGTACCTATCATACCTCGAGGTATGATAGGTACAGAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146325.1-580s21c1
Sequence:CCGGGGCTAGAAAGAAGTCTATTAGCTCGAGCTAATAGACTTCTTTCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001146325
TIGIT MISSION shRNA Lentiviral Transduction Particles
T cell immunoreceptor with Ig and ITIM domains
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146325.1-287s21c1
Sequence:CCGGGACCAGCTTCTGGCCATTTATCTCGAGATAAATGGCCAGAAGCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146325.1-170s21c1
Sequence:CCGGGCAGGCACGATAGATACAAAGCTCGAGCTTTGTATCTATCGTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146325.1-748s21c1
Sequence:CCGGTGACCCACAGGAATACTTTAACTCGAGTTAAAGTATTCCTGTGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146325.1-415s21c1
Sequence:CCGGGTACTTCTGTACCTATCATACCTCGAGGTATGATAGGTACAGAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146325.1-580s21c1
Sequence:CCGGGGCTAGAAAGAAGTCTATTAGCTCGAGCTAATAGACTTCTTTCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks