EMAIL THIS PAGE TO A FRIEND

TIMD4

T-cell immunoglobulin and mucin domain containing 4

Synonyms: SMUCKLER TIM4
UniProtKB ID: Q96H15, B5MCL9
Gene ID:
Mouse(276891) T cell immunoglobulin and mucin domain containing 4
Rat(497891) T-cell immunoglobulin and mucin domain containing 4
domestic guinea pig(101789332) T-cell immunoglobulin and mucin domain containing 4
naked mole-rat(101712531) T-cell immunoglobulin and mucin domain containing 4
cow(507549) T-cell immunoglobulin and mucin domain containing 4
sheep(101111631) T-cell immunoglobulin and mucin domain containing 4
Zebrafish(100142639) T-cell immunoglobulin and mucin domain containing 4
dog(489160) T-cell immunoglobulin and mucin domain containing 4
chicken(416250) T-cell immunoglobulin and mucin domain containing 4
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1746 Human TIM-4 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178759 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178759 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178759 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138379 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138379 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138379 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130671 MISSION® esiRNA esiRNA human TIMD4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138379 Rosetta Predictions human pricing
XM_573075 Rosetta Predictions rat pricing
XR_008627 Rosetta Predictions rat pricing
NM_178759 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138379 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193833 predicted 358
2 SASI_Hs01_00193834 predicted 631
3 SASI_Hs01_00193835 predicted 333
4 SASI_Hs02_00363505 predicted 772
5 SASI_Hs01_00193836 predicted 1024
6 SASI_Hs01_00193837 predicted 816
7 SASI_Hs01_00193838 predicted 1027
8 SASI_Hs01_00193839 predicted 359
9 SASI_Hs01_00193840 predicted 1034
10 SASI_Hs02_00363506 predicted 835
11 SASI_Hs01_00193832 predicted 954
12 SASI_Hs01_00193841 predicted 962
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573075 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00195189 predicted 785
2 SASI_Rn01_00195190 predicted 686
3 SASI_Rn01_00195191 predicted 699
4 SASI_Rn01_00195192 predicted 710
5 SASI_Rn01_00195193 predicted 704
6 SASI_Rn01_00195194 predicted 785
7 SASI_Rn01_00195195 predicted 751
8 SASI_Rn01_00195196 predicted 787
9 SASI_Rn01_00195197 predicted 870
10 SASI_Rn01_00195198 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008627 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00149027 predicted 924
2 SASI_Rn01_00149028 predicted 936
3 SASI_Rn01_00149029 predicted 761
4 SASI_Rn01_00149030 predicted 834
5 SASI_Rn01_00149031 predicted 706
6 SASI_Rn01_00149032 predicted 827
7 SASI_Rn01_00149033 predicted 838
8 SASI_Rn02_00417540 predicted 875
9 SASI_Rn01_00149034 predicted 967
10 SASI_Rn02_00417541 predicted 914
11 SASI_Rn01_00149035 predicted 699
12 SASI_Rn01_00149036 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178759 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349312 predicted 1064
2 SASI_Mm02_00349313 predicted 1068
3 SASI_Mm01_00149450 predicted 1044
4 SASI_Mm01_00149451 predicted 874
5 SASI_Mm02_00349314 predicted 1040
6 SASI_Mm01_00149453 predicted 789
7 SASI_Mm01_00149454 predicted 973
8 SASI_Mm01_00149455 predicted 1109
9 SASI_Mm01_00149456 predicted 875
10 SASI_Mm02_00349315 predicted 1114
11 SASI_Mm01_00149452 predicted 1413
12 SASI_Mm01_00149457 predicted 695
13 SASI_Mm01_00149458 predicted 1313
14 SASI_Mm01_00149459 predicted 1561
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178759
TIMD4 MISSION shRNA Bacterial Glycerol Stock
T-cell immunoglobulin and mucin domain containing 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178759.3-1730s1c1
Sequence:CCGGGCCTTAGTCCTCTTCGTTGTTCTCGAGAACAACGAAGAGGACTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178759.3-1145s1c1
Sequence:CCGGCCTTCACTACAGAATCAGAAACTCGAGTTTCTGATTCTGTAGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178759.3-586s1c1
Sequence:CCGGGCTGCCTCAGAGGATACAATACTCGAGTATTGTATCCTCTGAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178759.3-1171s1c1
Sequence:CCGGCCTGCATCCAATCACTCTCAACTCGAGTTGAGAGTGATTGGATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178759.3-686s1c1
Sequence:CCGGGCAAAGGTTCATGTCCCAATTCTCGAGAATTGGGACATGAACCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178759.4-788s21c1
Sequence:CCGGTTAACAACAAGTGAGTCTTTGCTCGAGCAAAGACTCACTTGTTGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178759.4-1050s21c1
Sequence:CCGGCCATCTTTATTTAGGATTAAGCTCGAGCTTAATCCTAAATAAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178759.4-1112s21c1
Sequence:CCGGCATTGTAATTTCCGTTTAAAGCTCGAGCTTTAAACGGAAATTACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178759
TIMD4 MISSION shRNA shRNA Plasmid DNA
T-cell immunoglobulin and mucin domain containing 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178759.3-1730s1c1
Sequence:CCGGGCCTTAGTCCTCTTCGTTGTTCTCGAGAACAACGAAGAGGACTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178759.3-1145s1c1
Sequence:CCGGCCTTCACTACAGAATCAGAAACTCGAGTTTCTGATTCTGTAGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178759.3-586s1c1
Sequence:CCGGGCTGCCTCAGAGGATACAATACTCGAGTATTGTATCCTCTGAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178759.3-1171s1c1
Sequence:CCGGCCTGCATCCAATCACTCTCAACTCGAGTTGAGAGTGATTGGATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178759.3-686s1c1
Sequence:CCGGGCAAAGGTTCATGTCCCAATTCTCGAGAATTGGGACATGAACCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178759.4-788s21c1
Sequence:CCGGTTAACAACAAGTGAGTCTTTGCTCGAGCAAAGACTCACTTGTTGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178759.4-1050s21c1
Sequence:CCGGCCATCTTTATTTAGGATTAAGCTCGAGCTTAATCCTAAATAAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178759.4-1112s21c1
Sequence:CCGGCATTGTAATTTCCGTTTAAAGCTCGAGCTTTAAACGGAAATTACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178759
TIMD4 MISSION shRNA Lentiviral Transduction Particles
T-cell immunoglobulin and mucin domain containing 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178759.3-1730s1c1
Sequence:CCGGGCCTTAGTCCTCTTCGTTGTTCTCGAGAACAACGAAGAGGACTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178759.3-1145s1c1
Sequence:CCGGCCTTCACTACAGAATCAGAAACTCGAGTTTCTGATTCTGTAGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178759.3-586s1c1
Sequence:CCGGGCTGCCTCAGAGGATACAATACTCGAGTATTGTATCCTCTGAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178759.3-1171s1c1
Sequence:CCGGCCTGCATCCAATCACTCTCAACTCGAGTTGAGAGTGATTGGATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178759.3-686s1c1
Sequence:CCGGGCAAAGGTTCATGTCCCAATTCTCGAGAATTGGGACATGAACCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178759.4-788s21c1
Sequence:CCGGTTAACAACAAGTGAGTCTTTGCTCGAGCAAAGACTCACTTGTTGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178759.4-1050s21c1
Sequence:CCGGCCATCTTTATTTAGGATTAAGCTCGAGCTTAATCCTAAATAAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178759.4-1112s21c1
Sequence:CCGGCATTGTAATTTCCGTTTAAAGCTCGAGCTTTAAACGGAAATTACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138379
TIMD4 MISSION shRNA Bacterial Glycerol Stock
T-cell immunoglobulin and mucin domain containing 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138379.1-524s1c1
Sequence:CCGGCCACCCGACAAATGACAACAACTCGAGTTGTTGTCATTTGTCGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138379.1-609s1c1
Sequence:CCGGGATGACAACCATTGCCGTCTTCTCGAGAAGACGGCAATGGTTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138379.1-821s1c1
Sequence:CCGGCCAAAGTTTGGGATCTCCCATCTCGAGATGGGAGATCCCAAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138379.1-337s1c1
Sequence:CCGGGATGTCTCCTTGACCATCTTACTCGAGTAAGATGGTCAAGGAGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138379.1-1081s1c1
Sequence:CCGGGAAACCTATTGTTCGCAGAAACTCGAGTTTCTGCGAACAATAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138379.1-964s1c1
Sequence:CCGGCCCATGTCAATGAAGAATGAACTCGAGTTCATTCTTCATTGACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138379.1-1098s1c1
Sequence:CCGGGAAACACACAAGGCTAGACTACTCGAGTAGTCTAGCCTTGTGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138379.1-901s1c1
Sequence:CCGGGCATCTGATACAGCAGTTCCTCTCGAGAGGAACTGCTGTATCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138379.1-804s1c1
Sequence:CCGGGCTGACATCCAAAGAGTCCAACTCGAGTTGGACTCTTTGGATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138379
TIMD4 MISSION shRNA shRNA Plasmid DNA
T-cell immunoglobulin and mucin domain containing 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138379.1-524s1c1
Sequence:CCGGCCACCCGACAAATGACAACAACTCGAGTTGTTGTCATTTGTCGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138379.1-609s1c1
Sequence:CCGGGATGACAACCATTGCCGTCTTCTCGAGAAGACGGCAATGGTTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138379.1-821s1c1
Sequence:CCGGCCAAAGTTTGGGATCTCCCATCTCGAGATGGGAGATCCCAAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138379.1-337s1c1
Sequence:CCGGGATGTCTCCTTGACCATCTTACTCGAGTAAGATGGTCAAGGAGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138379.1-1081s1c1
Sequence:CCGGGAAACCTATTGTTCGCAGAAACTCGAGTTTCTGCGAACAATAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138379.1-964s1c1
Sequence:CCGGCCCATGTCAATGAAGAATGAACTCGAGTTCATTCTTCATTGACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138379.1-1098s1c1
Sequence:CCGGGAAACACACAAGGCTAGACTACTCGAGTAGTCTAGCCTTGTGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138379.1-901s1c1
Sequence:CCGGGCATCTGATACAGCAGTTCCTCTCGAGAGGAACTGCTGTATCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138379.1-804s1c1
Sequence:CCGGGCTGACATCCAAAGAGTCCAACTCGAGTTGGACTCTTTGGATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138379
TIMD4 MISSION shRNA Lentiviral Transduction Particles
T-cell immunoglobulin and mucin domain containing 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138379.1-524s1c1
Sequence:CCGGCCACCCGACAAATGACAACAACTCGAGTTGTTGTCATTTGTCGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138379.1-609s1c1
Sequence:CCGGGATGACAACCATTGCCGTCTTCTCGAGAAGACGGCAATGGTTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138379.1-821s1c1
Sequence:CCGGCCAAAGTTTGGGATCTCCCATCTCGAGATGGGAGATCCCAAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138379.1-337s1c1
Sequence:CCGGGATGTCTCCTTGACCATCTTACTCGAGTAAGATGGTCAAGGAGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138379.1-1081s1c1
Sequence:CCGGGAAACCTATTGTTCGCAGAAACTCGAGTTTCTGCGAACAATAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138379.1-964s1c1
Sequence:CCGGCCCATGTCAATGAAGAATGAACTCGAGTTCATTCTTCATTGACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138379.1-1098s1c1
Sequence:CCGGGAAACACACAAGGCTAGACTACTCGAGTAGTCTAGCCTTGTGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138379.1-901s1c1
Sequence:CCGGGCATCTGATACAGCAGTTCCTCTCGAGAGGAACTGCTGTATCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138379.1-804s1c1
Sequence:CCGGGCTGACATCCAAAGAGTCCAACTCGAGTTGGACTCTTTGGATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks