EMAIL THIS PAGE TO A FRIEND

TIMELESS

timeless circadian clock

Synonyms: TIM TIM1 hTIM
UniProtKB ID: Q9UNS1, B2ZAV0, O94802, Q86VM1, Q8IWH3
Gene ID:
Mouse(21853) timeless circadian clock 1
Rat(83508) timeless circadian clock
Zebrafish(325855) timeless homolog (Drosophila)
dog(481112) timeless homolog (Drosophila)
domestic cat(101086404) timeless homolog (Drosophila)
Horse(100059661) timeless homolog (Drosophila)
cow(522884) timeless homolog (Drosophila)
naked mole-rat(101706199) timeless circadian clock
domestic guinea pig(100732412) timeless circadian clock
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV38403 Anti-TIMELESS (AB1) antibody produced in rabbit IgG fraction of antiserum , human, horse, canine, bovine, mouse, rabbit, rat, guinea pig, sheep
western blot pricing
AV38404 Anti-TIMELESS (AB2) antibody produced in rabbit IgG fraction of antiserum mouse, horse, guinea pig, human, canine, rat
western blot pricing
T6454 Anti-Timeless (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunoprecipitation, western blot pricing
T6579 Anti-Timeless (N-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunoprecipitation, western blot pricing
SAB1406756 Anti-TIMELESS antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
AV34186 Anti-TIMELESS antibody produced in rabbit affinity isolated antibody canine, guinea pig, human, horse, sheep, bovine, mouse, rat, rabbit
immunohistochemistry, western blot pricing
HPA060655 Anti-TIMELESS antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1411584 Anti-TIMELESS antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
PLA0159 Rabbit anti-Timeless Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. marmoset, human
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003920 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003920 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003920 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011589 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011589 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011589 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003920 Rosetta Predictions human pricing
NM_031340 Rosetta Predictions rat pricing
NM_011589 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003920 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010403 predicted 365
2 SASI_Hs01_00010404 predicted 784
3 SASI_Hs01_00010405 predicted 3121
4 SASI_Hs01_00010406 predicted 195
5 SASI_Hs01_00010408 predicted 3351
6 SASI_Hs01_00010409 predicted 3145
7 SASI_Hs01_00010410 predicted 240
8 SASI_Hs02_00336569 predicted 3490
9 SASI_Hs01_00010411 predicted 3843
10 SASI_Hs01_00010412 predicted 2689
11 SASI_Hs01_00010407 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031340 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031223 predicted 343
2 SASI_Rn01_00031224 predicted 3775
3 SASI_Rn01_00031225 predicted 486
4 SASI_Rn01_00031227 predicted 2807
5 SASI_Rn01_00031228 predicted 1015
6 SASI_Rn01_00031229 predicted 2984
7 SASI_Rn01_00031230 predicted 208
8 SASI_Rn01_00031231 predicted 2420
9 SASI_Rn02_00264574 predicted 3564
10 SASI_Rn01_00031232 predicted 3793
11 SASI_Rn01_00031226 predicted 3713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011589 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086471 predicted 2649
2 SASI_Mm01_00086472 predicted 2939
3 SASI_Mm01_00086473 predicted 2636
4 SASI_Mm01_00086474 predicted 3715
5 SASI_Mm01_00086475 predicted 2470
6 SASI_Mm01_00086476 predicted 2836
7 SASI_Mm01_00086477 predicted 3801
8 SASI_Mm01_00086478 predicted 512
9 SASI_Mm01_00086479 predicted 2435
10 SASI_Mm01_00086480 predicted 3683
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003920
VALIDATED
TIMELESS MISSION shRNA Bacterial Glycerol Stock
timeless circadian clock
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003920.3-3451s21c1
Sequence:CCGGGCAGCTTCTTTGAGTCAACCACTCGAGTGGTTGACTCAAAGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003920.3-3339s21c1
Sequence:CCGGCGAACAGTTTCAGCAGCTGTTCTCGAGAACAGCTGCTGAAACTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003920.3-1562s21c1
Sequence:CCGGGCCGCATCATCAAGAACAATACTCGAGTATTGTTCTTGATGATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003920.3-271s21c1
Sequence:CCGGGTGAAGGATCTGATCCGCTATCTCGAGATAGCGGATCAGATCCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003920.1-1766s1c1
Sequence:CCGGCAGGCCATTGTTTCTGGTAATCTCGAGATTACCAGAAACAATGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003920.1-1536s1c1
Sequence:CCGGGCCGCATCATCAAGAACAATACTCGAGTATTGTTCTTGATGATGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003920.1-590s1c1
Sequence:CCGGGAGGAAGACAACTTGCTGATTCTCGAGAATCAGCAAGTTGTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003920.1-662s1c1
Sequence:CCGGGATCAGGAGAAGAAGATTGATCTCGAGATCAATCTTCTTCTCCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003920.1-3737s1c1
Sequence:CCGGCGATACCAGATTGAGGATGATCTCGAGATCATCCTCAATCTGGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003920.1-1577s1c1
Sequence:CCGGCGAGAACTATTCCTGGCACTTCTCGAGAAGTGCCAGGAATAGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003920.1-245s1c1
Sequence:CCGGGTGAAGGATCTGATCCGCTATCTCGAGATAGCGGATCAGATCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003920.1-3425s1c1
Sequence:CCGGGCAGCTTCTTTGAGTCAACCACTCGAGTGGTTGACTCAAAGAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003920.1-2996s1c1
Sequence:CCGGGCATCCTCCATCTTGCCAAATCTCGAGATTTGGCAAGATGGAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003920.1-2297s1c1
Sequence:CCGGGCCCACACTAACCATTGCATTCTCGAGAATGCAATGGTTAGTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003920.1-3313s1c1
Sequence:CCGGCGAACAGTTTCAGCAGCTGTTCTCGAGAACAGCTGCTGAAACTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003920
VALIDATED
TIMELESS MISSION shRNA shRNA Plasmid DNA
timeless circadian clock
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003920.3-3451s21c1
Sequence:CCGGGCAGCTTCTTTGAGTCAACCACTCGAGTGGTTGACTCAAAGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003920.3-3339s21c1
Sequence:CCGGCGAACAGTTTCAGCAGCTGTTCTCGAGAACAGCTGCTGAAACTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003920.3-1562s21c1
Sequence:CCGGGCCGCATCATCAAGAACAATACTCGAGTATTGTTCTTGATGATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003920.3-271s21c1
Sequence:CCGGGTGAAGGATCTGATCCGCTATCTCGAGATAGCGGATCAGATCCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003920.1-1766s1c1
Sequence:CCGGCAGGCCATTGTTTCTGGTAATCTCGAGATTACCAGAAACAATGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003920.1-1536s1c1
Sequence:CCGGGCCGCATCATCAAGAACAATACTCGAGTATTGTTCTTGATGATGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003920.1-590s1c1
Sequence:CCGGGAGGAAGACAACTTGCTGATTCTCGAGAATCAGCAAGTTGTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003920.1-662s1c1
Sequence:CCGGGATCAGGAGAAGAAGATTGATCTCGAGATCAATCTTCTTCTCCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003920.1-3737s1c1
Sequence:CCGGCGATACCAGATTGAGGATGATCTCGAGATCATCCTCAATCTGGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003920.1-1577s1c1
Sequence:CCGGCGAGAACTATTCCTGGCACTTCTCGAGAAGTGCCAGGAATAGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003920.1-245s1c1
Sequence:CCGGGTGAAGGATCTGATCCGCTATCTCGAGATAGCGGATCAGATCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003920.1-3425s1c1
Sequence:CCGGGCAGCTTCTTTGAGTCAACCACTCGAGTGGTTGACTCAAAGAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003920.1-2996s1c1
Sequence:CCGGGCATCCTCCATCTTGCCAAATCTCGAGATTTGGCAAGATGGAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003920.1-2297s1c1
Sequence:CCGGGCCCACACTAACCATTGCATTCTCGAGAATGCAATGGTTAGTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003920.1-3313s1c1
Sequence:CCGGCGAACAGTTTCAGCAGCTGTTCTCGAGAACAGCTGCTGAAACTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003920
VALIDATED
TIMELESS MISSION shRNA Lentiviral Transduction Particles
timeless circadian clock
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003920.3-3451s21c1
Sequence:CCGGGCAGCTTCTTTGAGTCAACCACTCGAGTGGTTGACTCAAAGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003920.3-3339s21c1
Sequence:CCGGCGAACAGTTTCAGCAGCTGTTCTCGAGAACAGCTGCTGAAACTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003920.3-1562s21c1
Sequence:CCGGGCCGCATCATCAAGAACAATACTCGAGTATTGTTCTTGATGATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003920.3-271s21c1
Sequence:CCGGGTGAAGGATCTGATCCGCTATCTCGAGATAGCGGATCAGATCCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003920.1-1766s1c1
Sequence:CCGGCAGGCCATTGTTTCTGGTAATCTCGAGATTACCAGAAACAATGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003920.1-1536s1c1
Sequence:CCGGGCCGCATCATCAAGAACAATACTCGAGTATTGTTCTTGATGATGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003920.1-590s1c1
Sequence:CCGGGAGGAAGACAACTTGCTGATTCTCGAGAATCAGCAAGTTGTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003920.1-662s1c1
Sequence:CCGGGATCAGGAGAAGAAGATTGATCTCGAGATCAATCTTCTTCTCCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003920.1-3737s1c1
Sequence:CCGGCGATACCAGATTGAGGATGATCTCGAGATCATCCTCAATCTGGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003920.1-1577s1c1
Sequence:CCGGCGAGAACTATTCCTGGCACTTCTCGAGAAGTGCCAGGAATAGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003920.1-245s1c1
Sequence:CCGGGTGAAGGATCTGATCCGCTATCTCGAGATAGCGGATCAGATCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003920.1-3425s1c1
Sequence:CCGGGCAGCTTCTTTGAGTCAACCACTCGAGTGGTTGACTCAAAGAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003920.1-2996s1c1
Sequence:CCGGGCATCCTCCATCTTGCCAAATCTCGAGATTTGGCAAGATGGAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003920.1-2297s1c1
Sequence:CCGGGCCCACACTAACCATTGCATTCTCGAGAATGCAATGGTTAGTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003920.1-3313s1c1
Sequence:CCGGCGAACAGTTTCAGCAGCTGTTCTCGAGAACAGCTGCTGAAACTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011589
VALIDATED
TIMELESS MISSION shRNA Bacterial Glycerol Stock
timeless circadian clock
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011589.1-2841s21c1
Sequence:GTACCGGGATGATGTTCTTGGTCAAATCCTCGAGGATTTGACCAAGAACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011589.1-3898s21c1
Sequence:CCGGTGGGTCCGTCTCGTAGCAAATCTCGAGATTTGCTACGAGACGGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011589.1-1608s21c1
Sequence:CCGGAGATACCATCCACGCTCATTCCTCGAGGAATGAGCGTGGATGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011589.1-478s21c1
Sequence:CCGGCGTACCTGCAAGCCTACAAAGCTCGAGCTTTGTAGGCTTGCAGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011589.1-379s21c1
Sequence:CCGGTGATCAGGCTGATGGTAAATTCTCGAGAATTTACCATCAGCCTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097985    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011589.1-4135s1c1
Sequence:CCGGCCCTGATTTGTGTTTCATATTCTCGAGAATATGAAACACAAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011589.1-1376s1c1
Sequence:CCGGCCTCACCAACTACTACGAGATCTCGAGATCTCGTAGTAGTTGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011589.1-2945s1c1
Sequence:CCGGGCTATACAAGAAACGGAGAAACTCGAGTTTCTCCGTTTCTTGTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011589.1-3285s1c1
Sequence:CCGGGCAATGGAGAACGAACAGTTTCTCGAGAAACTGTTCGTTCTCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011589.1-3408s1c1
Sequence:CCGGGCTGCTTCTTTGAGTCAGCAACTCGAGTTGCTGACTCAAAGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011589
VALIDATED
TIMELESS MISSION shRNA shRNA Plasmid DNA
timeless circadian clock
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011589.1-2841s21c1
Sequence:GTACCGGGATGATGTTCTTGGTCAAATCCTCGAGGATTTGACCAAGAACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011589.1-3898s21c1
Sequence:CCGGTGGGTCCGTCTCGTAGCAAATCTCGAGATTTGCTACGAGACGGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011589.1-1608s21c1
Sequence:CCGGAGATACCATCCACGCTCATTCCTCGAGGAATGAGCGTGGATGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011589.1-478s21c1
Sequence:CCGGCGTACCTGCAAGCCTACAAAGCTCGAGCTTTGTAGGCTTGCAGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011589.1-379s21c1
Sequence:CCGGTGATCAGGCTGATGGTAAATTCTCGAGAATTTACCATCAGCCTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097985    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011589.1-4135s1c1
Sequence:CCGGCCCTGATTTGTGTTTCATATTCTCGAGAATATGAAACACAAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011589.1-1376s1c1
Sequence:CCGGCCTCACCAACTACTACGAGATCTCGAGATCTCGTAGTAGTTGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011589.1-2945s1c1
Sequence:CCGGGCTATACAAGAAACGGAGAAACTCGAGTTTCTCCGTTTCTTGTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011589.1-3285s1c1
Sequence:CCGGGCAATGGAGAACGAACAGTTTCTCGAGAAACTGTTCGTTCTCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011589.1-3408s1c1
Sequence:CCGGGCTGCTTCTTTGAGTCAGCAACTCGAGTTGCTGACTCAAAGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011589
VALIDATED
TIMELESS MISSION shRNA Lentiviral Transduction Particles
timeless circadian clock
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011589.1-2841s21c1
Sequence:GTACCGGGATGATGTTCTTGGTCAAATCCTCGAGGATTTGACCAAGAACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011589.1-3898s21c1
Sequence:CCGGTGGGTCCGTCTCGTAGCAAATCTCGAGATTTGCTACGAGACGGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011589.1-1608s21c1
Sequence:CCGGAGATACCATCCACGCTCATTCCTCGAGGAATGAGCGTGGATGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011589.1-478s21c1
Sequence:CCGGCGTACCTGCAAGCCTACAAAGCTCGAGCTTTGTAGGCTTGCAGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011589.1-379s21c1
Sequence:CCGGTGATCAGGCTGATGGTAAATTCTCGAGAATTTACCATCAGCCTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097985    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011589.1-4135s1c1
Sequence:CCGGCCCTGATTTGTGTTTCATATTCTCGAGAATATGAAACACAAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011589.1-1376s1c1
Sequence:CCGGCCTCACCAACTACTACGAGATCTCGAGATCTCGTAGTAGTTGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011589.1-2945s1c1
Sequence:CCGGGCTATACAAGAAACGGAGAAACTCGAGTTTCTCCGTTTCTTGTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011589.1-3285s1c1
Sequence:CCGGGCAATGGAGAACGAACAGTTTCTCGAGAAACTGTTCGTTCTCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011589.1-3408s1c1
Sequence:CCGGGCTGCTTCTTTGAGTCAGCAACTCGAGTTGCTGACTCAAAGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks