EMAIL THIS PAGE TO A FRIEND

TIMM10

translocase of inner mitochondrial membrane 10 homolog (yeast)

Synonyms: TIM10 TIM10A
UniProtKB ID: P62072, A8K136, Q9WV99, Q9WVA0, Q9Y5J8
Gene ID:
Human(26519) Summary: The mitochondrial protein encoded by this gene belongs to a family of evolutionarily conserved proteins that are organized in heterooligomeric complexes in the mitochondrial intermembrane space. These proteins mediate the import and insertion of hydrophobic membrane proteins into the mitochondrial inner membrane, functioning as intermembrane space chaperones for the highly insoluble carrier proteins. [provided by RefSeq, Nov 2011]
Mouse(30059) translocase of inner mitochondrial membrane 10
Rat(64464) translocase of inner mitochondrial membrane 10 homolog (yeast)
Zebrafish(436951) translocase of inner mitochondrial membrane 10 homolog (yeast)
domestic cat(101090046) translocase of inner mitochondrial membrane 10 homolog (yeast)
dog(475968) translocase of inner mitochondrial membrane 10 homolog (yeast)
chicken(425202) translocase of inner mitochondrial membrane 10 homolog (yeast)
domestic guinea pig(100722411) translocase of inner mitochondrial membrane 10 homolog (yeast)
naked mole-rat(101726401) translocase of inner mitochondrial membrane 10 homolog (yeast)
cow(512818) translocase of inner mitochondrial membrane 10 homolog (yeast)
sheep(101105775) translocase of inner mitochondrial membrane 10 homolog (yeast)
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012456 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012456 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012456 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013899 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013899 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013899 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012456 Rosetta Predictions human pricing
NM_172074 Rosetta Predictions rat pricing
NM_013899 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217193 predicted 233
2 SASI_Hs01_00217194 predicted 199
3 SASI_Hs01_00217196 predicted 191
4 SASI_Hs01_00217197 predicted 234
5 SASI_Hs01_00217198 predicted 298
6 SASI_Hs01_00217199 predicted 312
7 SASI_Hs01_00217200 predicted 214
8 SASI_Hs01_00217201 predicted 219
9 SASI_Hs01_00217202 predicted 283
10 SASI_Hs02_00344366 predicted 297
11 SASI_Hs01_00217195 predicted 207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172074 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269174 predicted 704
2 SASI_Rn01_00091947 predicted 614
3 SASI_Rn01_00091948 predicted 603
4 SASI_Rn01_00091949 predicted 727
5 SASI_Rn01_00091950 predicted 681
6 SASI_Rn01_00091951 predicted 719
7 SASI_Rn01_00091952 predicted 703
8 SASI_Rn01_00091953 predicted 765
9 SASI_Rn01_00091954 predicted 733
10 SASI_Rn01_00091955 predicted 712
11 SASI_Rn01_00091956 predicted 780
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013899 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074492 predicted 216
2 SASI_Mm01_00074494 predicted 306
3 SASI_Mm01_00074495 predicted 218
4 SASI_Mm02_00322963 predicted 215
5 SASI_Mm01_00074496 predicted 284
6 SASI_Mm02_00322964 predicted 311
7 SASI_Mm02_00322965 predicted 219
8 SASI_Mm01_00074498 predicted 327
9 SASI_Mm01_00074499 predicted 318
10 SASI_Mm02_00322966 predicted 327
11 SASI_Mm01_00074493 predicted 286
12 SASI_Mm01_00074497 predicted 310
13 SASI_Mm01_00074500 predicted 313
14 SASI_Mm01_00074501 predicted 229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012456
VALIDATED
TIMM10 MISSION shRNA Bacterial Glycerol Stock
translocase of inner mitochondrial membrane 10 homolog (yeast)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012456.1-294s1c1
Sequence:CCGGCTCTAAGTACCTGGACATCCACTCGAGTGGATGTCCAGGTACTTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012456.1-336s1c1
Sequence:CCGGGACAGAGTTGTCTATGCAGGACTCGAGTCCTGCATAGACAACTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012456.1-186s1c1
Sequence:CCGGCGATATGTACAACAGAATGACCTCGAGGTCATTCTGTTGTACATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012456.1-340s1c1
Sequence:CCGGGAGTTGTCTATGCAGGATGAACTCGAGTTCATCCTGCATAGACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012456.1-333s1c1
Sequence:CCGGGTTGACAGAGTTGTCTATGCACTCGAGTGCATAGACAACTCTGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012456.1-184s1c1
Sequence:CCGGGCCGATATGTACAACAGAATGCTCGAGCATTCTGTTGTACATATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012456.1-177s1c1
Sequence:CCGGGATGATGGCCGATATGTACAACTCGAGTTGTACATATCGGCCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012456.1-290s1c1
Sequence:CCGGGTGTCTCTAAGTACCTGGACACTCGAGTGTCCAGGTACTTAGAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012456.1-351s1c1
Sequence:CCGGGCAGGATGAAGAGCTGATGAACTCGAGTTCATCAGCTCTTCATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_012456.2-369s21c1
Sequence:CCGGGCAGGATGAAGAGCTGATGAACTCGAGTTCATCAGCTCTTCATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_012456.2-195s21c1
Sequence:CCGGGATGATGGCCGATATGTACAACTCGAGTTGTACATATCGGCCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_012456.2-312s21c1
Sequence:CCGGCTCTAAGTACCTGGACATCCACTCGAGTGGATGTCCAGGTACTTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_012456.2-354s21c1
Sequence:CCGGGACAGAGTTGTCTATGCAGGACTCGAGTCCTGCATAGACAACTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012456
VALIDATED
TIMM10 MISSION shRNA shRNA Plasmid DNA
translocase of inner mitochondrial membrane 10 homolog (yeast)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012456.1-294s1c1
Sequence:CCGGCTCTAAGTACCTGGACATCCACTCGAGTGGATGTCCAGGTACTTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012456.1-336s1c1
Sequence:CCGGGACAGAGTTGTCTATGCAGGACTCGAGTCCTGCATAGACAACTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012456.1-186s1c1
Sequence:CCGGCGATATGTACAACAGAATGACCTCGAGGTCATTCTGTTGTACATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012456.1-340s1c1
Sequence:CCGGGAGTTGTCTATGCAGGATGAACTCGAGTTCATCCTGCATAGACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012456.1-333s1c1
Sequence:CCGGGTTGACAGAGTTGTCTATGCACTCGAGTGCATAGACAACTCTGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012456.1-184s1c1
Sequence:CCGGGCCGATATGTACAACAGAATGCTCGAGCATTCTGTTGTACATATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012456.1-177s1c1
Sequence:CCGGGATGATGGCCGATATGTACAACTCGAGTTGTACATATCGGCCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012456.1-290s1c1
Sequence:CCGGGTGTCTCTAAGTACCTGGACACTCGAGTGTCCAGGTACTTAGAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012456.1-351s1c1
Sequence:CCGGGCAGGATGAAGAGCTGATGAACTCGAGTTCATCAGCTCTTCATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_012456.2-369s21c1
Sequence:CCGGGCAGGATGAAGAGCTGATGAACTCGAGTTCATCAGCTCTTCATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_012456.2-195s21c1
Sequence:CCGGGATGATGGCCGATATGTACAACTCGAGTTGTACATATCGGCCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_012456.2-312s21c1
Sequence:CCGGCTCTAAGTACCTGGACATCCACTCGAGTGGATGTCCAGGTACTTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_012456.2-354s21c1
Sequence:CCGGGACAGAGTTGTCTATGCAGGACTCGAGTCCTGCATAGACAACTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012456
VALIDATED
TIMM10 MISSION shRNA Lentiviral Transduction Particles
translocase of inner mitochondrial membrane 10 homolog (yeast)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012456.1-294s1c1
Sequence:CCGGCTCTAAGTACCTGGACATCCACTCGAGTGGATGTCCAGGTACTTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012456.1-336s1c1
Sequence:CCGGGACAGAGTTGTCTATGCAGGACTCGAGTCCTGCATAGACAACTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012456.1-186s1c1
Sequence:CCGGCGATATGTACAACAGAATGACCTCGAGGTCATTCTGTTGTACATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012456.1-340s1c1
Sequence:CCGGGAGTTGTCTATGCAGGATGAACTCGAGTTCATCCTGCATAGACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012456.1-333s1c1
Sequence:CCGGGTTGACAGAGTTGTCTATGCACTCGAGTGCATAGACAACTCTGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012456.1-184s1c1
Sequence:CCGGGCCGATATGTACAACAGAATGCTCGAGCATTCTGTTGTACATATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012456.1-177s1c1
Sequence:CCGGGATGATGGCCGATATGTACAACTCGAGTTGTACATATCGGCCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012456.1-290s1c1
Sequence:CCGGGTGTCTCTAAGTACCTGGACACTCGAGTGTCCAGGTACTTAGAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012456.1-351s1c1
Sequence:CCGGGCAGGATGAAGAGCTGATGAACTCGAGTTCATCAGCTCTTCATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_012456.2-369s21c1
Sequence:CCGGGCAGGATGAAGAGCTGATGAACTCGAGTTCATCAGCTCTTCATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_012456.2-195s21c1
Sequence:CCGGGATGATGGCCGATATGTACAACTCGAGTTGTACATATCGGCCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_012456.2-312s21c1
Sequence:CCGGCTCTAAGTACCTGGACATCCACTCGAGTGGATGTCCAGGTACTTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_012456.2-354s21c1
Sequence:CCGGGACAGAGTTGTCTATGCAGGACTCGAGTCCTGCATAGACAACTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013899
VALIDATED
TIMM10 MISSION shRNA Bacterial Glycerol Stock
translocase of inner mitochondrial membrane 10 homolog (yeast)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013899.1-382s1c1
Sequence:CCGGGCTGATGAAGAGGGTACAGCACTCGAGTGCTGTACCCTCTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013899.1-304s1c1
Sequence:CCGGCCGATGTGTATCCAAGTACTTCTCGAGAAGTACTTGGATACACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013899.1-322s1c1
Sequence:CCGGCTTGGACATCCATGAGAGGATCTCGAGATCCTCTCATGGATGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013899.1-201s1c1
Sequence:CCGGTGGCTGACATGTACAACAGAACTCGAGTTCTGTTGTACATGTCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114216    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013899.1-462s1c1
Sequence:CCGGGCCTGATTAAAGTGTCCCTAACTCGAGTTAGGGACACTTTAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013899.2-485s21c1
Sequence:CCGGGCCTGATTAAAGTGTCCCTAACTCGAGTTAGGGACACTTTAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013899.2-405s21c1
Sequence:CCGGGCTGATGAAGAGGGTACAGCACTCGAGTGCTGTACCCTCTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013899.2-327s21c1
Sequence:CCGGCCGATGTGTATCCAAGTACTTCTCGAGAAGTACTTGGATACACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013899.2-224s21c1
Sequence:CCGGTGGCTGACATGTACAACAGAACTCGAGTTCTGTTGTACATGTCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013899
VALIDATED
TIMM10 MISSION shRNA shRNA Plasmid DNA
translocase of inner mitochondrial membrane 10 homolog (yeast)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013899.1-382s1c1
Sequence:CCGGGCTGATGAAGAGGGTACAGCACTCGAGTGCTGTACCCTCTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013899.1-304s1c1
Sequence:CCGGCCGATGTGTATCCAAGTACTTCTCGAGAAGTACTTGGATACACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013899.1-322s1c1
Sequence:CCGGCTTGGACATCCATGAGAGGATCTCGAGATCCTCTCATGGATGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013899.1-201s1c1
Sequence:CCGGTGGCTGACATGTACAACAGAACTCGAGTTCTGTTGTACATGTCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114216    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013899.1-462s1c1
Sequence:CCGGGCCTGATTAAAGTGTCCCTAACTCGAGTTAGGGACACTTTAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013899.2-485s21c1
Sequence:CCGGGCCTGATTAAAGTGTCCCTAACTCGAGTTAGGGACACTTTAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013899.2-405s21c1
Sequence:CCGGGCTGATGAAGAGGGTACAGCACTCGAGTGCTGTACCCTCTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013899.2-327s21c1
Sequence:CCGGCCGATGTGTATCCAAGTACTTCTCGAGAAGTACTTGGATACACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013899.2-224s21c1
Sequence:CCGGTGGCTGACATGTACAACAGAACTCGAGTTCTGTTGTACATGTCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013899
VALIDATED
TIMM10 MISSION shRNA Lentiviral Transduction Particles
translocase of inner mitochondrial membrane 10 homolog (yeast)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013899.1-382s1c1
Sequence:CCGGGCTGATGAAGAGGGTACAGCACTCGAGTGCTGTACCCTCTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013899.1-304s1c1
Sequence:CCGGCCGATGTGTATCCAAGTACTTCTCGAGAAGTACTTGGATACACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013899.1-322s1c1
Sequence:CCGGCTTGGACATCCATGAGAGGATCTCGAGATCCTCTCATGGATGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013899.1-201s1c1
Sequence:CCGGTGGCTGACATGTACAACAGAACTCGAGTTCTGTTGTACATGTCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114216    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013899.1-462s1c1
Sequence:CCGGGCCTGATTAAAGTGTCCCTAACTCGAGTTAGGGACACTTTAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013899.2-485s21c1
Sequence:CCGGGCCTGATTAAAGTGTCCCTAACTCGAGTTAGGGACACTTTAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013899.2-405s21c1
Sequence:CCGGGCTGATGAAGAGGGTACAGCACTCGAGTGCTGTACCCTCTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013899.2-327s21c1
Sequence:CCGGCCGATGTGTATCCAAGTACTTCTCGAGAAGTACTTGGATACACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013899.2-224s21c1
Sequence:CCGGTGGCTGACATGTACAACAGAACTCGAGTTCTGTTGTACATGTCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks