EMAIL THIS PAGE TO A FRIEND

TIMM10B

translocase of inner mitochondrial membrane 10 homolog B (yeast)

Synonyms: FXC1 TIM10B Tim9b
UniProtKB ID: Q9Y5J6, Q96FF3
Gene ID:
Human(26515) Summary: FXC1, or TIMM10B, belongs to a family of evolutionarily conserved proteins that are organized in heterooligomeric complexes in the mitochondrial intermembrane space. These proteins mediate the import and insertion of hydrophobic membrane proteins into the mitochondrial inner membrane.[supplied by OMIM, Apr 2004]
Mouse(14356) translocase of inner mitochondrial membrane 10B
Rat(84384) translocase of inner mitochondrial membrane 10 homolog B
naked mole-rat(101704644) translocase of inner mitochondrial membrane 10 homolog B (yeast)
domestic guinea pig(100719483) translocase of inner mitochondrial membrane 10 homolog B (yeast)
Zebrafish(550527) translocase of inner mitochondrial membrane 10 homolog B (yeast)
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019502 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019502 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019502 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012192 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012192 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012192 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012192 Rosetta Predictions human pricing
NM_053371 Rosetta Predictions rat pricing
NM_019502 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012192 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025381 predicted 402
2 SASI_Hs01_00025376 predicted 412
3 SASI_Hs01_00025378 predicted 465
4 SASI_Hs02_00343823 predicted 509
5 SASI_Hs01_00025380 predicted 121
6 SASI_Hs02_00343824 predicted 123
7 SASI_Hs01_00025382 predicted 685
8 SASI_Hs02_00343825 predicted 567
9 SASI_Hs02_00343826 predicted 399
10 SASI_Hs02_00343827 predicted 405
11 SASI_Hs01_00025375 predicted 456
12 SASI_Hs01_00025377 predicted 460
13 SASI_Hs01_00025379 predicted 558
14 SASI_Hs01_00025383 predicted 247
15 SASI_Hs01_00025384 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053371 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075580 predicted 517
2 SASI_Rn02_00265851 predicted 418
3 SASI_Rn02_00265852 predicted 464
4 SASI_Rn01_00075584 predicted 491
5 SASI_Rn01_00075586 predicted 535
6 SASI_Rn01_00075587 predicted 534
7 SASI_Rn02_00265853 predicted 359
8 SASI_Rn02_00265854 predicted 197
9 SASI_Rn02_00265855 predicted 449
10 SASI_Rn02_00265856 predicted 309
11 SASI_Rn01_00075581 predicted 534
12 SASI_Rn01_00075582 predicted 491
13 SASI_Rn01_00075583 predicted 493
14 SASI_Rn01_00075585 predicted 508
15 SASI_Rn01_00075588 predicted 491
16 SASI_Rn01_00075589 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019502 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063998 predicted 426
2 SASI_Mm01_00063999 predicted 533
3 SASI_Mm01_00064000 predicted 397
4 SASI_Mm01_00064001 predicted 658
5 SASI_Mm01_00064002 predicted 735
6 SASI_Mm01_00064003 predicted 377
7 SASI_Mm01_00064004 predicted 391
8 SASI_Mm02_00324540 predicted 307
9 SASI_Mm01_00064005 predicted 230
10 SASI_Mm01_00064006 predicted 570
11 SASI_Mm01_00064007 predicted 206
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019502
VALIDATED
TIMM10B MISSION shRNA Bacterial Glycerol Stock
translocase of inner mitochondrial membrane 10 homolog B (yeast)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019502.2-199s21c1
Sequence:CCGGGTGCTGGGAAACTCATCCATTCTCGAGAATGGATGAGTTTCCCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019502.2-649s21c1
Sequence:CCGGTAGAGCTTTAAGGTTAGTAATCTCGAGATTACTAACCTTAAAGCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019502.2-312s21c1
Sequence:CCGGGGTATTCCTGCAGAACAGACCCTCGAGGGTCTGTTCTGCAGGAATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019502.2-224s21c1
Sequence:CCGGCCACCGCCTCATGGCCGCTTACTCGAGTAAGCGGCCATGAGGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019502.2-95s21c1
Sequence:CCGGCCTGTTGGTCTACAATCGGATCTCGAGATCCGATTGTAGACCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019502.2-734s1c1
Sequence:CCGGCCTGAATATACATTGACTCATCTCGAGATGAGTCAATGTATATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019502.2-224s1c1
Sequence:CCGGCCACCGCCTCATGGCCGCTTACTCGAGTAAGCGGCCATGAGGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019502.2-335s1c1
Sequence:CCGGAGACTCGCCATCAGGCAGCTACTCGAGTAGCTGCCTGATGGCGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019502.2-199s1c1
Sequence:CCGGGTGCTGGGAAACTCATCCATTCTCGAGAATGGATGAGTTTCCCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019502.2-95s1c1
Sequence:CCGGCCTGTTGGTCTACAATCGGATCTCGAGATCCGATTGTAGACCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019502
VALIDATED
TIMM10B MISSION shRNA shRNA Plasmid DNA
translocase of inner mitochondrial membrane 10 homolog B (yeast)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019502.2-199s21c1
Sequence:CCGGGTGCTGGGAAACTCATCCATTCTCGAGAATGGATGAGTTTCCCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019502.2-649s21c1
Sequence:CCGGTAGAGCTTTAAGGTTAGTAATCTCGAGATTACTAACCTTAAAGCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019502.2-312s21c1
Sequence:CCGGGGTATTCCTGCAGAACAGACCCTCGAGGGTCTGTTCTGCAGGAATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019502.2-224s21c1
Sequence:CCGGCCACCGCCTCATGGCCGCTTACTCGAGTAAGCGGCCATGAGGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019502.2-95s21c1
Sequence:CCGGCCTGTTGGTCTACAATCGGATCTCGAGATCCGATTGTAGACCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019502.2-734s1c1
Sequence:CCGGCCTGAATATACATTGACTCATCTCGAGATGAGTCAATGTATATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019502.2-224s1c1
Sequence:CCGGCCACCGCCTCATGGCCGCTTACTCGAGTAAGCGGCCATGAGGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019502.2-335s1c1
Sequence:CCGGAGACTCGCCATCAGGCAGCTACTCGAGTAGCTGCCTGATGGCGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019502.2-199s1c1
Sequence:CCGGGTGCTGGGAAACTCATCCATTCTCGAGAATGGATGAGTTTCCCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019502.2-95s1c1
Sequence:CCGGCCTGTTGGTCTACAATCGGATCTCGAGATCCGATTGTAGACCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019502
VALIDATED
TIMM10B MISSION shRNA Lentiviral Transduction Particles
translocase of inner mitochondrial membrane 10 homolog B (yeast)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019502.2-199s21c1
Sequence:CCGGGTGCTGGGAAACTCATCCATTCTCGAGAATGGATGAGTTTCCCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019502.2-649s21c1
Sequence:CCGGTAGAGCTTTAAGGTTAGTAATCTCGAGATTACTAACCTTAAAGCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019502.2-312s21c1
Sequence:CCGGGGTATTCCTGCAGAACAGACCCTCGAGGGTCTGTTCTGCAGGAATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019502.2-224s21c1
Sequence:CCGGCCACCGCCTCATGGCCGCTTACTCGAGTAAGCGGCCATGAGGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019502.2-95s21c1
Sequence:CCGGCCTGTTGGTCTACAATCGGATCTCGAGATCCGATTGTAGACCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019502.2-734s1c1
Sequence:CCGGCCTGAATATACATTGACTCATCTCGAGATGAGTCAATGTATATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019502.2-224s1c1
Sequence:CCGGCCACCGCCTCATGGCCGCTTACTCGAGTAAGCGGCCATGAGGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019502.2-335s1c1
Sequence:CCGGAGACTCGCCATCAGGCAGCTACTCGAGTAGCTGCCTGATGGCGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019502.2-199s1c1
Sequence:CCGGGTGCTGGGAAACTCATCCATTCTCGAGAATGGATGAGTTTCCCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019502.2-95s1c1
Sequence:CCGGCCTGTTGGTCTACAATCGGATCTCGAGATCCGATTGTAGACCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012192
VALIDATED
TIMM10B MISSION shRNA Bacterial Glycerol Stock
translocase of inner mitochondrial membrane 10 homolog B (yeast)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_012192.3-230s21c1
Sequence:CCGGGGGAAGCTGATCCATTCCAACCTCGAGGTTGGAATGGATCAGCTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012192.3-140s21c1
Sequence:CCGGATGACAGAACTCTGCTTCCAGCTCGAGCTGGAAGCAGAGTTCTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012192.3-367s21c1
Sequence:CCGGTCCATCAGGCAGCTAGCCATACTCGAGTATGGCTAGCTGCCTGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_012192.3-117s21c1
Sequence:CCGGACTTCCTGTTGGTCTACAATCCTCGAGGATTGTAGACCAACAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012192.3-1989s21c1
Sequence:CCGGCAAGTAGCAGACCCGGTATTACTCGAGTAATACCGGGTCTGCTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149048    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012192.2-1289s1c1
Sequence:CCGGGAAGAGAAACTGAAGGGAGAACTCGAGTTCTCCCTTCAGTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012192.2-127s1c1
Sequence:CCGGGATGACAGAACTCTGCTTCCACTCGAGTGGAAGCAGAGTTCTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_012192.2-220s1c1
Sequence:CCGGGAAGCTGATCCATTCCAACCACTCGAGTGGTTGGAATGGATCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_012192.2-104s1c1
Sequence:CCGGGACTTCCTGTTGGTCTACAATCTCGAGATTGTAGACCAACAGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012192
VALIDATED
TIMM10B MISSION shRNA shRNA Plasmid DNA
translocase of inner mitochondrial membrane 10 homolog B (yeast)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_012192.3-230s21c1
Sequence:CCGGGGGAAGCTGATCCATTCCAACCTCGAGGTTGGAATGGATCAGCTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012192.3-140s21c1
Sequence:CCGGATGACAGAACTCTGCTTCCAGCTCGAGCTGGAAGCAGAGTTCTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012192.3-367s21c1
Sequence:CCGGTCCATCAGGCAGCTAGCCATACTCGAGTATGGCTAGCTGCCTGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_012192.3-117s21c1
Sequence:CCGGACTTCCTGTTGGTCTACAATCCTCGAGGATTGTAGACCAACAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012192.3-1989s21c1
Sequence:CCGGCAAGTAGCAGACCCGGTATTACTCGAGTAATACCGGGTCTGCTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149048    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012192.2-1289s1c1
Sequence:CCGGGAAGAGAAACTGAAGGGAGAACTCGAGTTCTCCCTTCAGTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012192.2-127s1c1
Sequence:CCGGGATGACAGAACTCTGCTTCCACTCGAGTGGAAGCAGAGTTCTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_012192.2-220s1c1
Sequence:CCGGGAAGCTGATCCATTCCAACCACTCGAGTGGTTGGAATGGATCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_012192.2-104s1c1
Sequence:CCGGGACTTCCTGTTGGTCTACAATCTCGAGATTGTAGACCAACAGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012192
VALIDATED
TIMM10B MISSION shRNA Lentiviral Transduction Particles
translocase of inner mitochondrial membrane 10 homolog B (yeast)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_012192.3-230s21c1
Sequence:CCGGGGGAAGCTGATCCATTCCAACCTCGAGGTTGGAATGGATCAGCTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012192.3-140s21c1
Sequence:CCGGATGACAGAACTCTGCTTCCAGCTCGAGCTGGAAGCAGAGTTCTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012192.3-367s21c1
Sequence:CCGGTCCATCAGGCAGCTAGCCATACTCGAGTATGGCTAGCTGCCTGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_012192.3-117s21c1
Sequence:CCGGACTTCCTGTTGGTCTACAATCCTCGAGGATTGTAGACCAACAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012192.3-1989s21c1
Sequence:CCGGCAAGTAGCAGACCCGGTATTACTCGAGTAATACCGGGTCTGCTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149048    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012192.2-1289s1c1
Sequence:CCGGGAAGAGAAACTGAAGGGAGAACTCGAGTTCTCCCTTCAGTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012192.2-127s1c1
Sequence:CCGGGATGACAGAACTCTGCTTCCACTCGAGTGGAAGCAGAGTTCTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_012192.2-220s1c1
Sequence:CCGGGAAGCTGATCCATTCCAACCACTCGAGTGGTTGGAATGGATCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_012192.2-104s1c1
Sequence:CCGGGACTTCCTGTTGGTCTACAATCTCGAGATTGTAGACCAACAGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks