EMAIL THIS PAGE TO A FRIEND

TIMM13

translocase of inner mitochondrial membrane 13 homolog (yeast)

Synonyms: TIM13 TIM13B TIMM13A TIMM13B ppv1
UniProtKB ID: Q9Y5L4, P62206, Q9UHL8, Q9WTL1
Gene ID:
Human(26517) Summary: This gene encodes a translocase with similarity to yeast mitochondrial proteins that are involved in the import of metabolite transporters from the cytoplasm and into the mitochondrial inner membrane. The encoded protein and the TIMM8a protein form a 70 kDa complex in the intermembrane space. This gene is in a head-to-tail orientation with the gene for lamin B2. [provided by RefSeq, Jul 2008]
Mouse(30055) translocase of inner mitochondrial membrane 13
Rat(252928) translocase of inner mitochondrial membrane 13 homolog (yeast)
Zebrafish(436738) translocase of inner mitochondrial membrane 13 homolog (yeast)
chicken(100859352) translocase of inner mitochondrial membrane 13 homolog (yeast)
domestic guinea pig(100719357) translocase of inner mitochondrial membrane 13 homolog (yeast)
naked mole-rat(101707329) translocase of inner mitochondrial membrane 13 homolog (yeast)
cow(516325) translocase of inner mitochondrial membrane 13 homolog (yeast)
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013895 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013895 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013895 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012458 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012458 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012458 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012458 Rosetta Predictions human pricing
NM_145781 Rosetta Predictions rat pricing
NM_013895 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012644 predicted 466
2 SASI_Hs01_00012645 predicted 543
3 SASI_Hs01_00012646 predicted 464
4 SASI_Hs01_00012647 predicted 457
5 SASI_Hs02_00344367 predicted 398
6 SASI_Hs01_00012648 predicted 513
7 SASI_Hs01_00012649 predicted 478
8 SASI_Hs01_00012650 predicted 396
9 SASI_Hs01_00012652 predicted 519
10 SASI_Hs01_00012653 predicted 550
11 SASI_Hs01_00012651 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145781 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095710 predicted 518
2 SASI_Rn01_00095711 predicted 232
3 SASI_Rn01_00095712 predicted 449
4 SASI_Rn01_00095713 predicted 561
5 SASI_Rn01_00095714 predicted 385
6 SASI_Rn01_00095715 predicted 516
7 SASI_Rn01_00095716 predicted 525
8 SASI_Rn01_00095717 predicted 246
9 SASI_Rn01_00095718 predicted 229
10 SASI_Rn01_00095719 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013895 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322950 predicted 353
2 SASI_Mm01_00046265 predicted 970
3 SASI_Mm01_00046266 predicted 532
4 SASI_Mm01_00046267 predicted 416
5 SASI_Mm02_00322951 predicted 284
6 SASI_Mm01_00046270 predicted 435
7 SASI_Mm01_00046271 predicted 953
8 SASI_Mm01_00046272 predicted 777
9 SASI_Mm01_00046273 predicted 408
10 SASI_Mm02_00322952 predicted 991
11 SASI_Mm01_00046264 predicted 528
12 SASI_Mm01_00046268 predicted 441
13 SASI_Mm01_00046269 predicted 675
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013895
VALIDATED
TIMM13 MISSION shRNA Bacterial Glycerol Stock
translocase of inner mitochondrial membrane 13 homolog (yeast)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013895.2-731s1c1
Sequence:CCGGGCTTCATGTAGCCTTCACCTACTCGAGTAGGTGAAGGCTACATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013895.2-213s1c1
Sequence:CCGGGAAATGCATCGCCATGTGCATCTCGAGATGCACATGGCGATGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177392    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013895.2-853s1c1
Sequence:CCGGGAGGATTGGTACATGAGATTTCTCGAGAAATCTCATGTACCAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013895.2-144s1c1
Sequence:CCGGGAGAATGACGGACAAGTGTTTCTCGAGAAACACTTGTCCGTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013895.4-290s21c1
Sequence:CCGGATTATGGAGCAGGTGAAAGTGCTCGAGCACTTTCACCTGCTCCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013895.4-346s21c1
Sequence:CCGGGAGAATGACGGACAAGTGTTTCTCGAGAAACACTTGTCCGTCATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013895.4-492s21c1
Sequence:CCGGAGCGGGAACGAGCCAACATGTCTCGAGACATGTTGGCTCGTTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013895.4-441s21c1
Sequence:CCGGGCTACATGGACGCCTGGAATACTCGAGTATTCCAGGCGTCCATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013895.4-815s21c1
Sequence:CCGGAGACCTCCCAGGGTATCTTTCCTCGAGGAAAGATACCCTGGGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013895
VALIDATED
TIMM13 MISSION shRNA shRNA Plasmid DNA
translocase of inner mitochondrial membrane 13 homolog (yeast)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013895.2-731s1c1
Sequence:CCGGGCTTCATGTAGCCTTCACCTACTCGAGTAGGTGAAGGCTACATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013895.2-213s1c1
Sequence:CCGGGAAATGCATCGCCATGTGCATCTCGAGATGCACATGGCGATGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177392    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013895.2-853s1c1
Sequence:CCGGGAGGATTGGTACATGAGATTTCTCGAGAAATCTCATGTACCAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013895.2-144s1c1
Sequence:CCGGGAGAATGACGGACAAGTGTTTCTCGAGAAACACTTGTCCGTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013895.4-290s21c1
Sequence:CCGGATTATGGAGCAGGTGAAAGTGCTCGAGCACTTTCACCTGCTCCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013895.4-346s21c1
Sequence:CCGGGAGAATGACGGACAAGTGTTTCTCGAGAAACACTTGTCCGTCATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013895.4-492s21c1
Sequence:CCGGAGCGGGAACGAGCCAACATGTCTCGAGACATGTTGGCTCGTTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013895.4-441s21c1
Sequence:CCGGGCTACATGGACGCCTGGAATACTCGAGTATTCCAGGCGTCCATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013895.4-815s21c1
Sequence:CCGGAGACCTCCCAGGGTATCTTTCCTCGAGGAAAGATACCCTGGGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013895
VALIDATED
TIMM13 MISSION shRNA Lentiviral Transduction Particles
translocase of inner mitochondrial membrane 13 homolog (yeast)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013895.2-731s1c1
Sequence:CCGGGCTTCATGTAGCCTTCACCTACTCGAGTAGGTGAAGGCTACATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013895.2-213s1c1
Sequence:CCGGGAAATGCATCGCCATGTGCATCTCGAGATGCACATGGCGATGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177392    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013895.2-853s1c1
Sequence:CCGGGAGGATTGGTACATGAGATTTCTCGAGAAATCTCATGTACCAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013895.2-144s1c1
Sequence:CCGGGAGAATGACGGACAAGTGTTTCTCGAGAAACACTTGTCCGTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013895.4-290s21c1
Sequence:CCGGATTATGGAGCAGGTGAAAGTGCTCGAGCACTTTCACCTGCTCCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013895.4-346s21c1
Sequence:CCGGGAGAATGACGGACAAGTGTTTCTCGAGAAACACTTGTCCGTCATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013895.4-492s21c1
Sequence:CCGGAGCGGGAACGAGCCAACATGTCTCGAGACATGTTGGCTCGTTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013895.4-441s21c1
Sequence:CCGGGCTACATGGACGCCTGGAATACTCGAGTATTCCAGGCGTCCATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013895.4-815s21c1
Sequence:CCGGAGACCTCCCAGGGTATCTTTCCTCGAGGAAAGATACCCTGGGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012458
VALIDATED
TIMM13 MISSION shRNA Bacterial Glycerol Stock
translocase of inner mitochondrial membrane 13 homolog (yeast)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_012458.2-486s1c1
Sequence:CCGGCGGAAGTGTATAGGGAAACCTCTCGAGAGGTTTCCCTATACACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012458.2-981s1c1
Sequence:CCGGCCTGCGGATGGGCAAATAAATCTCGAGATTTATTTGCCCATCCGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_012458.2-656s1c1
Sequence:CCGGCCTGTTCATTTCCATAAACGTCTCGAGACGTTTATGGAAATGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012458.2-407s1c1
Sequence:CCGGCATAATGGAGCAGGTGAAAGTCTCGAGACTTTCACCTGCTCCATTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012458.2-464s1c1
Sequence:CCGGGAGGATGACGGACAAGTGTTTCTCGAGAAACACTTGTCCGTCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012458.2-474s1c1
Sequence:CCGGGACAAGTGTTTCCGGAAGTGTCTCGAGACACTTCCGGAAACACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012458.2-481s1c1
Sequence:CCGGGTTTCCGGAAGTGTATAGGGACTCGAGTCCCTATACACTTCCGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_012458.2-464s21c1
Sequence:CCGGGAGGATGACGGACAAGTGTTTCTCGAGAAACACTTGTCCGTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273622    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_012458.2-656s21c1
Sequence:CCGGCCTGTTCATTTCCATAAACGTCTCGAGACGTTTATGGAAATGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_012458.2-545s21c1
Sequence:CCGGCATGTGCATGGACCGCTACATCTCGAGATGTAGCGGTCCATGCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_012458.2-981s21c1
Sequence:CCGGCCTGCGGATGGGCAAATAAATCTCGAGATTTATTTGCCCATCCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012458
VALIDATED
TIMM13 MISSION shRNA shRNA Plasmid DNA
translocase of inner mitochondrial membrane 13 homolog (yeast)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_012458.2-486s1c1
Sequence:CCGGCGGAAGTGTATAGGGAAACCTCTCGAGAGGTTTCCCTATACACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012458.2-981s1c1
Sequence:CCGGCCTGCGGATGGGCAAATAAATCTCGAGATTTATTTGCCCATCCGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_012458.2-656s1c1
Sequence:CCGGCCTGTTCATTTCCATAAACGTCTCGAGACGTTTATGGAAATGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012458.2-407s1c1
Sequence:CCGGCATAATGGAGCAGGTGAAAGTCTCGAGACTTTCACCTGCTCCATTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012458.2-464s1c1
Sequence:CCGGGAGGATGACGGACAAGTGTTTCTCGAGAAACACTTGTCCGTCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012458.2-474s1c1
Sequence:CCGGGACAAGTGTTTCCGGAAGTGTCTCGAGACACTTCCGGAAACACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012458.2-481s1c1
Sequence:CCGGGTTTCCGGAAGTGTATAGGGACTCGAGTCCCTATACACTTCCGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_012458.2-464s21c1
Sequence:CCGGGAGGATGACGGACAAGTGTTTCTCGAGAAACACTTGTCCGTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273622    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_012458.2-656s21c1
Sequence:CCGGCCTGTTCATTTCCATAAACGTCTCGAGACGTTTATGGAAATGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_012458.2-545s21c1
Sequence:CCGGCATGTGCATGGACCGCTACATCTCGAGATGTAGCGGTCCATGCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_012458.2-981s21c1
Sequence:CCGGCCTGCGGATGGGCAAATAAATCTCGAGATTTATTTGCCCATCCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012458
VALIDATED
TIMM13 MISSION shRNA Lentiviral Transduction Particles
translocase of inner mitochondrial membrane 13 homolog (yeast)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_012458.2-486s1c1
Sequence:CCGGCGGAAGTGTATAGGGAAACCTCTCGAGAGGTTTCCCTATACACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012458.2-981s1c1
Sequence:CCGGCCTGCGGATGGGCAAATAAATCTCGAGATTTATTTGCCCATCCGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_012458.2-656s1c1
Sequence:CCGGCCTGTTCATTTCCATAAACGTCTCGAGACGTTTATGGAAATGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012458.2-407s1c1
Sequence:CCGGCATAATGGAGCAGGTGAAAGTCTCGAGACTTTCACCTGCTCCATTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012458.2-464s1c1
Sequence:CCGGGAGGATGACGGACAAGTGTTTCTCGAGAAACACTTGTCCGTCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012458.2-474s1c1
Sequence:CCGGGACAAGTGTTTCCGGAAGTGTCTCGAGACACTTCCGGAAACACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012458.2-481s1c1
Sequence:CCGGGTTTCCGGAAGTGTATAGGGACTCGAGTCCCTATACACTTCCGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_012458.2-464s21c1
Sequence:CCGGGAGGATGACGGACAAGTGTTTCTCGAGAAACACTTGTCCGTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273622    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_012458.2-656s21c1
Sequence:CCGGCCTGTTCATTTCCATAAACGTCTCGAGACGTTTATGGAAATGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_012458.2-545s21c1
Sequence:CCGGCATGTGCATGGACCGCTACATCTCGAGATGTAGCGGTCCATGCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_012458.2-981s21c1
Sequence:CCGGCCTGCGGATGGGCAAATAAATCTCGAGATTTATTTGCCCATCCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks