EMAIL THIS PAGE TO A FRIEND

TIMM17A

translocase of inner mitochondrial membrane 17 homolog A (yeast)

Synonyms: TIM17 TIM17A
UniProtKB ID: Q99595, B2RDM5, Q9BWF5
Gene ID:
Mouse(21854) translocase of inner mitochondrial membrane 17a
Rat(54311) translocase of inner mitochondrial membrane 17 homolog A (yeast)
cow(509797) translocase of inner mitochondrial membrane 17 homolog A (yeast)
sheep(101113949) translocase of inner mitochondrial membrane 17 homolog A (yeast)
naked mole-rat(101717832) translocase of inner mitochondrial membrane 17 homolog A (yeast)
domestic guinea pig(100731865) translocase of inner mitochondrial membrane 17 homolog A (yeast)
Zebrafish(386636) translocase of inner mitochondrial membrane 17 homolog A (yeast)
dog(480001) translocase of inner mitochondrial membrane 17 homolog A (yeast)
domestic cat(101097369) translocase of inner mitochondrial membrane 17 homolog A (yeast)
chicken(421147) translocase of inner mitochondrial membrane 17 homolog A (yeast)
117 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011590 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011590 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011590 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006335 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006335 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006335 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006335 Rosetta Predictions human pricing
NM_019351 Rosetta Predictions rat pricing
NM_011590 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105097 predicted 386
2 SASI_Hs01_00105098 predicted 493
3 SASI_Hs01_00105099 predicted 473
4 SASI_Hs01_00105100 predicted 504
5 SASI_Hs01_00105101 predicted 226
6 SASI_Hs01_00105102 predicted 612
7 SASI_Hs02_00341372 predicted 301
8 SASI_Hs01_00105103 predicted 717
9 SASI_Hs01_00105104 predicted 807
10 SASI_Hs01_00105105 predicted 776
11 SASI_Hs01_00105106 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019351 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262354 predicted 622
2 SASI_Rn02_00262355 predicted 800
3 SASI_Rn01_00114559 predicted 416
4 SASI_Rn01_00114560 predicted 506
5 SASI_Rn01_00114561 predicted 578
6 SASI_Rn01_00114562 predicted 408
7 SASI_Rn01_00114563 predicted 231
8 SASI_Rn01_00114564 predicted 565
9 SASI_Rn01_00114565 predicted 281
10 SASI_Rn01_00114566 predicted 394
11 SASI_Rn01_00114567 predicted 233
12 SASI_Rn01_00114568 predicted 584
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011590 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156406 predicted 489
2 SASI_Mm01_00156407 predicted 438
3 SASI_Mm01_00156408 predicted 501
4 SASI_Mm01_00156409 predicted 495
5 SASI_Mm01_00156410 predicted 564
6 SASI_Mm01_00156411 predicted 560
7 SASI_Mm01_00156412 predicted 755
8 SASI_Mm01_00156413 predicted 562
9 SASI_Mm01_00156414 predicted 70
10 SASI_Mm01_00156415 predicted 822
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011590
VALIDATED
TIMM17A MISSION shRNA Bacterial Glycerol Stock
translocase of inner mitochondrial membrane 17 homolog A (yeast)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011590.2-163s21c1
Sequence:CCGGCGAGGAAGTTTGACAGCTATTCTCGAGAATAGCTGTCAAACTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011590.2-303s21c1
Sequence:CCGGCGGTGCCTTAACAGGAGCCATCTCGAGATGGCTCCTGTTAAGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011590.2-139s21c1
Sequence:CCGGCCAGTGGGAATAAACCACAGACTCGAGTCTGTGGTTTATTCCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011590.2-374s21c1
Sequence:CCGGGCGGCATTCTCCTAGCTTTAACTCGAGTTAAAGCTAGGAGAATGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011590.2-643s21c1
Sequence:CCGGCGGGCCATAAAGAGACATTTACTCGAGTAAATGTCTCTTTATGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011590.1-644s1c1
Sequence:CCGGCGGGCCATAAAGAGACATTTACTCGAGTAAATGTCTCTTTATGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011590.1-164s1c1
Sequence:CCGGCGAGGAAGTTTGACAGCTATTCTCGAGAATAGCTGTCAAACTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011590.1-304s1c1
Sequence:CCGGCGGTGCCTTAACAGGAGCCATCTCGAGATGGCTCCTGTTAAGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011590.1-140s1c1
Sequence:CCGGCCAGTGGGAATAAACCACAGACTCGAGTCTGTGGTTTATTCCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011590.1-375s1c1
Sequence:CCGGGCGGCATTCTCCTAGCTTTAACTCGAGTTAAAGCTAGGAGAATGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011590
VALIDATED
TIMM17A MISSION shRNA shRNA Plasmid DNA
translocase of inner mitochondrial membrane 17 homolog A (yeast)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011590.2-163s21c1
Sequence:CCGGCGAGGAAGTTTGACAGCTATTCTCGAGAATAGCTGTCAAACTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011590.2-303s21c1
Sequence:CCGGCGGTGCCTTAACAGGAGCCATCTCGAGATGGCTCCTGTTAAGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011590.2-139s21c1
Sequence:CCGGCCAGTGGGAATAAACCACAGACTCGAGTCTGTGGTTTATTCCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011590.2-374s21c1
Sequence:CCGGGCGGCATTCTCCTAGCTTTAACTCGAGTTAAAGCTAGGAGAATGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011590.2-643s21c1
Sequence:CCGGCGGGCCATAAAGAGACATTTACTCGAGTAAATGTCTCTTTATGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011590.1-644s1c1
Sequence:CCGGCGGGCCATAAAGAGACATTTACTCGAGTAAATGTCTCTTTATGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011590.1-164s1c1
Sequence:CCGGCGAGGAAGTTTGACAGCTATTCTCGAGAATAGCTGTCAAACTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011590.1-304s1c1
Sequence:CCGGCGGTGCCTTAACAGGAGCCATCTCGAGATGGCTCCTGTTAAGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011590.1-140s1c1
Sequence:CCGGCCAGTGGGAATAAACCACAGACTCGAGTCTGTGGTTTATTCCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011590.1-375s1c1
Sequence:CCGGGCGGCATTCTCCTAGCTTTAACTCGAGTTAAAGCTAGGAGAATGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011590
VALIDATED
TIMM17A MISSION shRNA Lentiviral Transduction Particles
translocase of inner mitochondrial membrane 17 homolog A (yeast)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011590.2-163s21c1
Sequence:CCGGCGAGGAAGTTTGACAGCTATTCTCGAGAATAGCTGTCAAACTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011590.2-303s21c1
Sequence:CCGGCGGTGCCTTAACAGGAGCCATCTCGAGATGGCTCCTGTTAAGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011590.2-139s21c1
Sequence:CCGGCCAGTGGGAATAAACCACAGACTCGAGTCTGTGGTTTATTCCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011590.2-374s21c1
Sequence:CCGGGCGGCATTCTCCTAGCTTTAACTCGAGTTAAAGCTAGGAGAATGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011590.2-643s21c1
Sequence:CCGGCGGGCCATAAAGAGACATTTACTCGAGTAAATGTCTCTTTATGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011590.1-644s1c1
Sequence:CCGGCGGGCCATAAAGAGACATTTACTCGAGTAAATGTCTCTTTATGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011590.1-164s1c1
Sequence:CCGGCGAGGAAGTTTGACAGCTATTCTCGAGAATAGCTGTCAAACTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011590.1-304s1c1
Sequence:CCGGCGGTGCCTTAACAGGAGCCATCTCGAGATGGCTCCTGTTAAGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011590.1-140s1c1
Sequence:CCGGCCAGTGGGAATAAACCACAGACTCGAGTCTGTGGTTTATTCCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011590.1-375s1c1
Sequence:CCGGGCGGCATTCTCCTAGCTTTAACTCGAGTTAAAGCTAGGAGAATGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006335
VALIDATED
TIMM17A MISSION shRNA Bacterial Glycerol Stock
translocase of inner mitochondrial membrane 17 homolog A (yeast)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006335.2-272s21c1
Sequence:CCGGGTATGGTTCAAGTCAGAGGAACTCGAGTTCCTCTGACTTGAACCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006335.2-526s21c1
Sequence:CCGGTTTGGAGACTATCGACAATATCTCGAGATATTGTCGATAGTCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_006335.2-1286s21c1
Sequence:CCGGGCACTGGAAGAGTTTAGTGTTCTCGAGAACACTAAACTCTTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006335.2-184s21c1
Sequence:CCGGGGGAGTTTGACAGCTATTAAACTCGAGTTTAATAGCTGTCAAACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006335.2-421s21c1
Sequence:CCGGGCTGGTATCTTGTTGACAAGACTCGAGTCTTGTCAACAAGATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006335.1-243s1c1
Sequence:CCGGGTATGGTTCAAGTCAGAGGAACTCGAGTTCCTCTGACTTGAACCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006335.1-378s1c1
Sequence:CCGGCTTTAATTGAAGGAGCTGGTACTCGAGTACCAGCTCCTTCAATTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006335.1-392s1c1
Sequence:CCGGGCTGGTATCTTGTTGACAAGACTCGAGTCTTGTCAACAAGATACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006335.1-1380s1c1
Sequence:CCGGGCACTTCAGAACAGGTCATTTCTCGAGAAATGACCTGTTCTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006335.1-1256s1c1
Sequence:CCGGGCACTGGAAGAGTTTAGTGTTCTCGAGAACACTAAACTCTTCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006335
VALIDATED
TIMM17A MISSION shRNA shRNA Plasmid DNA
translocase of inner mitochondrial membrane 17 homolog A (yeast)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006335.2-272s21c1
Sequence:CCGGGTATGGTTCAAGTCAGAGGAACTCGAGTTCCTCTGACTTGAACCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006335.2-526s21c1
Sequence:CCGGTTTGGAGACTATCGACAATATCTCGAGATATTGTCGATAGTCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_006335.2-1286s21c1
Sequence:CCGGGCACTGGAAGAGTTTAGTGTTCTCGAGAACACTAAACTCTTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006335.2-184s21c1
Sequence:CCGGGGGAGTTTGACAGCTATTAAACTCGAGTTTAATAGCTGTCAAACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006335.2-421s21c1
Sequence:CCGGGCTGGTATCTTGTTGACAAGACTCGAGTCTTGTCAACAAGATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006335.1-243s1c1
Sequence:CCGGGTATGGTTCAAGTCAGAGGAACTCGAGTTCCTCTGACTTGAACCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006335.1-378s1c1
Sequence:CCGGCTTTAATTGAAGGAGCTGGTACTCGAGTACCAGCTCCTTCAATTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006335.1-392s1c1
Sequence:CCGGGCTGGTATCTTGTTGACAAGACTCGAGTCTTGTCAACAAGATACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006335.1-1380s1c1
Sequence:CCGGGCACTTCAGAACAGGTCATTTCTCGAGAAATGACCTGTTCTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006335.1-1256s1c1
Sequence:CCGGGCACTGGAAGAGTTTAGTGTTCTCGAGAACACTAAACTCTTCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006335
VALIDATED
TIMM17A MISSION shRNA Lentiviral Transduction Particles
translocase of inner mitochondrial membrane 17 homolog A (yeast)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006335.2-272s21c1
Sequence:CCGGGTATGGTTCAAGTCAGAGGAACTCGAGTTCCTCTGACTTGAACCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006335.2-526s21c1
Sequence:CCGGTTTGGAGACTATCGACAATATCTCGAGATATTGTCGATAGTCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_006335.2-1286s21c1
Sequence:CCGGGCACTGGAAGAGTTTAGTGTTCTCGAGAACACTAAACTCTTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006335.2-184s21c1
Sequence:CCGGGGGAGTTTGACAGCTATTAAACTCGAGTTTAATAGCTGTCAAACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006335.2-421s21c1
Sequence:CCGGGCTGGTATCTTGTTGACAAGACTCGAGTCTTGTCAACAAGATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006335.1-243s1c1
Sequence:CCGGGTATGGTTCAAGTCAGAGGAACTCGAGTTCCTCTGACTTGAACCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006335.1-378s1c1
Sequence:CCGGCTTTAATTGAAGGAGCTGGTACTCGAGTACCAGCTCCTTCAATTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006335.1-392s1c1
Sequence:CCGGGCTGGTATCTTGTTGACAAGACTCGAGTCTTGTCAACAAGATACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006335.1-1380s1c1
Sequence:CCGGGCACTTCAGAACAGGTCATTTCTCGAGAAATGACCTGTTCTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006335.1-1256s1c1
Sequence:CCGGGCACTGGAAGAGTTTAGTGTTCTCGAGAACACTAAACTCTTCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks