EMAIL THIS PAGE TO A FRIEND

TIMM17B

translocase of inner mitochondrial membrane 17 homolog B (yeast)

Synonyms: DXS9822 TIM17B
UniProtKB ID: O60830, A8K2E2, J3KPV3, Q9UJV0
Gene ID:
Human(10245) Summary: This gene encodes a protein that is part of the mitochondrial transport TIMM23 complex. TIM translocase complexes facilitate the transport of mitochondrial proteins from the cytosol across the mitochondrial inner membrane and into the mitochondrion. Two alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
Mouse(21855) translocase of inner mitochondrial membrane 17b
Rat(317374) translocase of inner mitochondrial membrane 17 homolog B (yeast)
domestic guinea pig(100731796) translocase of inner mitochondrial membrane 17 homolog B (yeast)
naked mole-rat(101710584) translocase of inner mitochondrial membrane 17 homolog B (yeast)
cow(540765) translocase of inner mitochondrial membrane 17 homolog B (yeast)
sheep(101108454) translocase of inner mitochondrial membrane 17 homolog B (yeast)
Zebrafish(562144) translocase of inner mitochondrial membrane 17 homolog B (yeast)
domestic cat(101096954) translocase of inner mitochondrial membrane 17 homolog B (yeast)
dog(480908) translocase of inner mitochondrial membrane 17 homolog B (yeast)
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA029093 Anti-TIMM17B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011591 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011591 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011591 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005834 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005834 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005834 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032651 MISSION® esiRNA esiRNA human TIMM17B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005834 Rosetta Predictions human pricing
NM_001108249 Rosetta Predictions rat pricing
NM_011591 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211312 predicted 287
2 SASI_Hs01_00211317 predicted 293
3 SASI_Hs02_00340365 predicted 689
4 SASI_Hs01_00211309 predicted 407
5 SASI_Hs02_00340366 predicted 243
6 SASI_Hs01_00211310 predicted 474
7 SASI_Hs01_00211311 predicted 279
8 SASI_Hs01_00211313 predicted 356
9 SASI_Hs02_00340367 predicted 239
10 SASI_Hs01_00211316 predicted 529
11 SASI_Hs01_00211314 predicted 360
12 SASI_Hs01_00211315 predicted 290
13 SASI_Hs01_00211318 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108249 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236794 predicted 446
2 SASI_Rn02_00236795 predicted 427
3 SASI_Rn02_00236796 predicted 346
4 SASI_Rn02_00236797 predicted 421
5 SASI_Rn02_00236798 predicted 418
6 SASI_Rn02_00236799 predicted 431
7 SASI_Rn02_00236800 predicted 222
8 SASI_Rn02_00236801 predicted 197
9 SASI_Rn02_00236802 predicted 322
10 SASI_Rn02_00236803 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011591 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320985 predicted 533
2 SASI_Mm02_00320986 predicted 726
3 SASI_Mm02_00320987 predicted 428
4 SASI_Mm02_00320988 predicted 247
5 SASI_Mm02_00320989 predicted 676
6 SASI_Mm02_00320990 predicted 660
7 SASI_Mm02_00320991 predicted 399
8 SASI_Mm02_00320992 predicted 664
9 SASI_Mm02_00320993 predicted 650
10 SASI_Mm02_00320994 predicted 606
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011591
VALIDATED
TIMM17B MISSION shRNA Bacterial Glycerol Stock
translocase of inner mitochondrial membrane 17 homolog B (yeast)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114226    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011591.2-1241s1c1
Sequence:CCGGCCCAACCTTTAGTAAAGGTTTCTCGAGAAACCTTTACTAAAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011591.2-105s1c1
Sequence:CCGGGCTTTCACCATGGGTGTCATTCTCGAGAATGACACCCATGGTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011591.2-75s1c1
Sequence:CCGGCCATGGCGAATTGTGGATGATCTCGAGATCATCCACAATTCGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011591.2-449s1c1
Sequence:CCGGCCGCTATACTGCCCAGCAGTTCTCGAGAACTGCTGGGCAGTATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011591.2-185s1c1
Sequence:CCGGCCGGTTCAGAGGTAGTGTCAACTCGAGTTGACACTACCTCTGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348207    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011591.4-773s21c1
Sequence:CCGGAGCTTCATACGTGTAACAATTCTCGAGAATTGTTACACGTATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011591.4-184s21c1
Sequence:CCGGCCGGTTCAGAGGTAGTGTCAACTCGAGTTGACACTACCTCTGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011591.4-435s21c1
Sequence:CCGGGCATCCTTCTCACCCGCTATACTCGAGTATAGCGGGTGAGAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011591.4-104s21c1
Sequence:CCGGGCTTTCACCATGGGTGTCATTCTCGAGAATGACACCCATGGTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011591
VALIDATED
TIMM17B MISSION shRNA shRNA Plasmid DNA
translocase of inner mitochondrial membrane 17 homolog B (yeast)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114226    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011591.2-1241s1c1
Sequence:CCGGCCCAACCTTTAGTAAAGGTTTCTCGAGAAACCTTTACTAAAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011591.2-105s1c1
Sequence:CCGGGCTTTCACCATGGGTGTCATTCTCGAGAATGACACCCATGGTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011591.2-75s1c1
Sequence:CCGGCCATGGCGAATTGTGGATGATCTCGAGATCATCCACAATTCGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011591.2-449s1c1
Sequence:CCGGCCGCTATACTGCCCAGCAGTTCTCGAGAACTGCTGGGCAGTATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011591.2-185s1c1
Sequence:CCGGCCGGTTCAGAGGTAGTGTCAACTCGAGTTGACACTACCTCTGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348207    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011591.4-773s21c1
Sequence:CCGGAGCTTCATACGTGTAACAATTCTCGAGAATTGTTACACGTATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011591.4-184s21c1
Sequence:CCGGCCGGTTCAGAGGTAGTGTCAACTCGAGTTGACACTACCTCTGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011591.4-435s21c1
Sequence:CCGGGCATCCTTCTCACCCGCTATACTCGAGTATAGCGGGTGAGAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011591.4-104s21c1
Sequence:CCGGGCTTTCACCATGGGTGTCATTCTCGAGAATGACACCCATGGTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011591
VALIDATED
TIMM17B MISSION shRNA Lentiviral Transduction Particles
translocase of inner mitochondrial membrane 17 homolog B (yeast)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114226    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011591.2-1241s1c1
Sequence:CCGGCCCAACCTTTAGTAAAGGTTTCTCGAGAAACCTTTACTAAAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011591.2-105s1c1
Sequence:CCGGGCTTTCACCATGGGTGTCATTCTCGAGAATGACACCCATGGTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011591.2-75s1c1
Sequence:CCGGCCATGGCGAATTGTGGATGATCTCGAGATCATCCACAATTCGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011591.2-449s1c1
Sequence:CCGGCCGCTATACTGCCCAGCAGTTCTCGAGAACTGCTGGGCAGTATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011591.2-185s1c1
Sequence:CCGGCCGGTTCAGAGGTAGTGTCAACTCGAGTTGACACTACCTCTGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348207    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011591.4-773s21c1
Sequence:CCGGAGCTTCATACGTGTAACAATTCTCGAGAATTGTTACACGTATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011591.4-184s21c1
Sequence:CCGGCCGGTTCAGAGGTAGTGTCAACTCGAGTTGACACTACCTCTGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011591.4-435s21c1
Sequence:CCGGGCATCCTTCTCACCCGCTATACTCGAGTATAGCGGGTGAGAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011591.4-104s21c1
Sequence:CCGGGCTTTCACCATGGGTGTCATTCTCGAGAATGACACCCATGGTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005834
VALIDATED
TIMM17B MISSION shRNA Bacterial Glycerol Stock
translocase of inner mitochondrial membrane 17 homolog B (yeast)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005834.1-177s1c1
Sequence:CCGGCCATGGCGAATTGTGGATGATCTCGAGATCATCCACAATTCGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005834.1-363s1c1
Sequence:CCGGCTGTTCTCCACCATTGACTGTCTCGAGACAGTCAATGGTGGAGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005834.1-761s21c1
Sequence:CCGGCCTCCAGAGAGGGTTTCTACTCTCGAGAGTAGAAACCCTCTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005834.1-558s21c1
Sequence:CCGGACAGCCCAGCAGTTCCGAAATCTCGAGATTTCGGAACTGCTGGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005834.1-423s21c1
Sequence:CCGGTCTATCACCAGTGGAGCATTGCTCGAGCAATGCTCCACTGGTGATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005834.1-247s21c1
Sequence:CCGGCCATCAAGGGTTTCCGCAATGCTCGAGCATTGCGGAAACCCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005834.1-196s21c1
Sequence:CCGGATTGCGGTGGAGCCTTCACTACTCGAGTAGTGAAGGCTCCACCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005834
VALIDATED
TIMM17B MISSION shRNA shRNA Plasmid DNA
translocase of inner mitochondrial membrane 17 homolog B (yeast)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005834.1-177s1c1
Sequence:CCGGCCATGGCGAATTGTGGATGATCTCGAGATCATCCACAATTCGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005834.1-363s1c1
Sequence:CCGGCTGTTCTCCACCATTGACTGTCTCGAGACAGTCAATGGTGGAGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005834.1-761s21c1
Sequence:CCGGCCTCCAGAGAGGGTTTCTACTCTCGAGAGTAGAAACCCTCTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005834.1-558s21c1
Sequence:CCGGACAGCCCAGCAGTTCCGAAATCTCGAGATTTCGGAACTGCTGGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005834.1-423s21c1
Sequence:CCGGTCTATCACCAGTGGAGCATTGCTCGAGCAATGCTCCACTGGTGATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005834.1-247s21c1
Sequence:CCGGCCATCAAGGGTTTCCGCAATGCTCGAGCATTGCGGAAACCCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005834.1-196s21c1
Sequence:CCGGATTGCGGTGGAGCCTTCACTACTCGAGTAGTGAAGGCTCCACCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005834
VALIDATED
TIMM17B MISSION shRNA Lentiviral Transduction Particles
translocase of inner mitochondrial membrane 17 homolog B (yeast)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005834.1-177s1c1
Sequence:CCGGCCATGGCGAATTGTGGATGATCTCGAGATCATCCACAATTCGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005834.1-363s1c1
Sequence:CCGGCTGTTCTCCACCATTGACTGTCTCGAGACAGTCAATGGTGGAGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005834.1-761s21c1
Sequence:CCGGCCTCCAGAGAGGGTTTCTACTCTCGAGAGTAGAAACCCTCTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005834.1-558s21c1
Sequence:CCGGACAGCCCAGCAGTTCCGAAATCTCGAGATTTCGGAACTGCTGGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005834.1-423s21c1
Sequence:CCGGTCTATCACCAGTGGAGCATTGCTCGAGCAATGCTCCACTGGTGATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005834.1-247s21c1
Sequence:CCGGCCATCAAGGGTTTCCGCAATGCTCGAGCATTGCGGAAACCCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005834.1-196s21c1
Sequence:CCGGATTGCGGTGGAGCCTTCACTACTCGAGTAGTGAAGGCTCCACCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks