EMAIL THIS PAGE TO A FRIEND

TIMM21

translocase of inner mitochondrial membrane 21 homolog (yeast)

Synonyms: C18orf55 TIM21
UniProtKB ID: Q9BVV7, Q9P010
Gene ID:
Mouse(67105) tranlocase of inner mitochondrial membrane 21
Rat(307210) translocase of inner mitochondrial membrane 21 homolog (yeast)
dog(476170) translocase of inner mitochondrial membrane 21 homolog (yeast)
domestic cat(101095524) translocase of inner mitochondrial membrane 21 homolog (yeast)
cow(614633) translocase of inner mitochondrial membrane 21 homolog (yeast)
sheep(101123430) translocase of inner mitochondrial membrane 21 homolog (yeast)
naked mole-rat(101712569) translocase of inner mitochondrial membrane 21 homolog (yeast)
domestic guinea pig(100736190) translocase of inner mitochondrial membrane 21 homolog (yeast)
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025969 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025969 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025969 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014177 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014177 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014177 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014177 Rosetta Predictions human pricing
NM_001008343 Rosetta Predictions rat pricing
NM_025969 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345186 predicted 367
2 SASI_Hs01_00208175 predicted 595
3 SASI_Hs01_00208177 predicted 872
4 SASI_Hs01_00208178 predicted 967
5 SASI_Hs01_00208180 predicted 623
6 SASI_Hs02_00345187 predicted 379
7 SASI_Hs01_00208181 predicted 412
8 SASI_Hs02_00345188 predicted 861
9 SASI_Hs02_00345189 predicted 413
10 SASI_Hs02_00345190 predicted 708
11 SASI_Hs01_00208173 predicted 557
12 SASI_Hs01_00208174 predicted 284
13 SASI_Hs01_00208176 predicted 931
14 SASI_Hs01_00208179 predicted 558
15 SASI_Hs01_00208182 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008343 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085076 predicted 909
2 SASI_Rn01_00085077 predicted 617
3 SASI_Rn01_00085078 predicted 736
4 SASI_Rn01_00085079 predicted 369
5 SASI_Rn01_00085081 predicted 558
6 SASI_Rn01_00085082 predicted 612
7 SASI_Rn01_00085083 predicted 780
8 SASI_Rn01_00085080 predicted 738
9 SASI_Rn02_00199094 predicted 479
10 SASI_Rn02_00199095 predicted 1004
11 SASI_Rn01_00085084 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025969 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042764 predicted 372
2 SASI_Mm01_00042765 predicted 878
3 SASI_Mm01_00042766 predicted 574
4 SASI_Mm01_00042767 predicted 779
5 SASI_Mm01_00042768 predicted 628
6 SASI_Mm01_00042769 predicted 568
7 SASI_Mm01_00042771 predicted 558
8 SASI_Mm01_00042772 predicted 780
9 SASI_Mm01_00042773 predicted 586
10 SASI_Mm02_00329388 predicted 554
11 SASI_Mm01_00042770 predicted 843
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025969
VALIDATED
TIMM21 MISSION shRNA Bacterial Glycerol Stock
translocase of inner mitochondrial membrane 21 homolog (yeast)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025969.1-877s1c1
Sequence:CCGGGCCAGTTTGAATTTCGATACACTCGAGTGTATCGAAATTCAAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025969.1-600s1c1
Sequence:CCGGGCGATCTTCAAAGAACTGTTTCTCGAGAAACAGTTCTTTGAAGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025969.1-465s1c1
Sequence:CCGGCAAGTGTCTATTCGCAGAAATCTCGAGATTTCTGCGAATAGACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025969.1-625s1c1
Sequence:CCGGCGTCCAGCCCTAATATCATATCTCGAGATATGATATTAGGGCTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025969.1-1102s1c1
Sequence:CCGGGTTTGGATCAACTGAGGTCTTCTCGAGAAGACCTCAGTTGATCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025969
VALIDATED
TIMM21 MISSION shRNA shRNA Plasmid DNA
translocase of inner mitochondrial membrane 21 homolog (yeast)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025969.1-877s1c1
Sequence:CCGGGCCAGTTTGAATTTCGATACACTCGAGTGTATCGAAATTCAAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025969.1-600s1c1
Sequence:CCGGGCGATCTTCAAAGAACTGTTTCTCGAGAAACAGTTCTTTGAAGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025969.1-465s1c1
Sequence:CCGGCAAGTGTCTATTCGCAGAAATCTCGAGATTTCTGCGAATAGACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025969.1-625s1c1
Sequence:CCGGCGTCCAGCCCTAATATCATATCTCGAGATATGATATTAGGGCTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025969.1-1102s1c1
Sequence:CCGGGTTTGGATCAACTGAGGTCTTCTCGAGAAGACCTCAGTTGATCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025969
VALIDATED
TIMM21 MISSION shRNA Lentiviral Transduction Particles
translocase of inner mitochondrial membrane 21 homolog (yeast)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025969.1-877s1c1
Sequence:CCGGGCCAGTTTGAATTTCGATACACTCGAGTGTATCGAAATTCAAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025969.1-600s1c1
Sequence:CCGGGCGATCTTCAAAGAACTGTTTCTCGAGAAACAGTTCTTTGAAGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025969.1-465s1c1
Sequence:CCGGCAAGTGTCTATTCGCAGAAATCTCGAGATTTCTGCGAATAGACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025969.1-625s1c1
Sequence:CCGGCGTCCAGCCCTAATATCATATCTCGAGATATGATATTAGGGCTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025969.1-1102s1c1
Sequence:CCGGGTTTGGATCAACTGAGGTCTTCTCGAGAAGACCTCAGTTGATCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014177
TIMM21 MISSION shRNA Bacterial Glycerol Stock
translocase of inner mitochondrial membrane 21 homolog (yeast)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014177.1-760s1c1
Sequence:CCGGGCTGAAACACACGTGTGTGAACTCGAGTTCACACACGTGTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014177.1-1042s1c1
Sequence:CCGGCAAGAAGGAGTGTATGGCTTACTCGAGTAAGCCATACACTCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014177.1-280s1c1
Sequence:CCGGCATCGTGCTTAACAAAGCGTACTCGAGTACGCTTTGTTAAGCACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014177.1-1155s1c1
Sequence:CCGGCCATTGACTCAATCATGACAACTCGAGTTGTCATGATTGAGTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014177.1-669s1c1
Sequence:CCGGGTGTCTTTGGTGAGTCTGTTACTCGAGTAACAGACTCACCAAAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014177.1-318s1c1
Sequence:CCGGGTTTGAGATGTGGGCTTCAATCTCGAGATTGAAGCCCACATCTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014177.1-283s1c1
Sequence:CCGGCGTGCTTAACAAAGCGTACTTCTCGAGAAGTACGCTTTGTTAAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014177.1-954s1c1
Sequence:CCGGGCAAGCAGGTTTCTGATGGATCTCGAGATCCATCAGAAACCTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014177.1-500s1c1
Sequence:CCGGGTGAAAGAAGCCGGAAGAGATCTCGAGATCTCTTCCGGCTTCTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014177
TIMM21 MISSION shRNA shRNA Plasmid DNA
translocase of inner mitochondrial membrane 21 homolog (yeast)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014177.1-760s1c1
Sequence:CCGGGCTGAAACACACGTGTGTGAACTCGAGTTCACACACGTGTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014177.1-1042s1c1
Sequence:CCGGCAAGAAGGAGTGTATGGCTTACTCGAGTAAGCCATACACTCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014177.1-280s1c1
Sequence:CCGGCATCGTGCTTAACAAAGCGTACTCGAGTACGCTTTGTTAAGCACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014177.1-1155s1c1
Sequence:CCGGCCATTGACTCAATCATGACAACTCGAGTTGTCATGATTGAGTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014177.1-669s1c1
Sequence:CCGGGTGTCTTTGGTGAGTCTGTTACTCGAGTAACAGACTCACCAAAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014177.1-318s1c1
Sequence:CCGGGTTTGAGATGTGGGCTTCAATCTCGAGATTGAAGCCCACATCTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014177.1-283s1c1
Sequence:CCGGCGTGCTTAACAAAGCGTACTTCTCGAGAAGTACGCTTTGTTAAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014177.1-954s1c1
Sequence:CCGGGCAAGCAGGTTTCTGATGGATCTCGAGATCCATCAGAAACCTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014177.1-500s1c1
Sequence:CCGGGTGAAAGAAGCCGGAAGAGATCTCGAGATCTCTTCCGGCTTCTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014177
TIMM21 MISSION shRNA Lentiviral Transduction Particles
translocase of inner mitochondrial membrane 21 homolog (yeast)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014177.1-760s1c1
Sequence:CCGGGCTGAAACACACGTGTGTGAACTCGAGTTCACACACGTGTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014177.1-1042s1c1
Sequence:CCGGCAAGAAGGAGTGTATGGCTTACTCGAGTAAGCCATACACTCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014177.1-280s1c1
Sequence:CCGGCATCGTGCTTAACAAAGCGTACTCGAGTACGCTTTGTTAAGCACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014177.1-1155s1c1
Sequence:CCGGCCATTGACTCAATCATGACAACTCGAGTTGTCATGATTGAGTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014177.1-669s1c1
Sequence:CCGGGTGTCTTTGGTGAGTCTGTTACTCGAGTAACAGACTCACCAAAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014177.1-318s1c1
Sequence:CCGGGTTTGAGATGTGGGCTTCAATCTCGAGATTGAAGCCCACATCTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014177.1-283s1c1
Sequence:CCGGCGTGCTTAACAAAGCGTACTTCTCGAGAAGTACGCTTTGTTAAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014177.1-954s1c1
Sequence:CCGGGCAAGCAGGTTTCTGATGGATCTCGAGATCCATCAGAAACCTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014177.1-500s1c1
Sequence:CCGGGTGAAAGAAGCCGGAAGAGATCTCGAGATCTCTTCCGGCTTCTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks