EMAIL THIS PAGE TO A FRIEND

TIMM22

translocase of inner mitochondrial membrane 22 homolog (yeast)

Synonyms: TEX4 TIM22
UniProtKB ID: Q9Y584, Q9NWI8
Gene ID:
Mouse(56322) translocase of inner mitochondrial membrane 22
Rat(79463) translocase of inner mitochondrial membrane 22 homolog (yeast)
domestic guinea pig(100715979) translocase of inner mitochondrial membrane 22 homolog (yeast)
naked mole-rat(101710728) translocase of inner mitochondrial membrane 22 homolog (yeast)
cow(515555) translocase of inner mitochondrial membrane 22 homolog (yeast)
sheep(101123313) translocase of inner mitochondrial membrane 22 homolog (yeast)
chicken(417594) translocase of inner mitochondrial membrane 22 homolog (yeast)
dog(480639) translocase of inner mitochondrial membrane 22 homolog (yeast)
domestic cat(101089408) translocase of inner mitochondrial membrane 22 homolog (yeast)
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013337 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013337 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013337 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019818 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019818 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019818 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU160361 MISSION® esiRNA esiRNA human TIMM22 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013337 Rosetta Predictions human pricing
XM_001080619 Rosetta Predictions rat pricing
XM_340856 Rosetta Predictions rat pricing
NM_019818 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049864 predicted 407
2 SASI_Hs01_00049865 predicted 408
3 SASI_Hs01_00049866 predicted 721
4 SASI_Hs01_00049867 predicted 326
5 SASI_Hs01_00049868 predicted 214
6 SASI_Hs01_00049869 predicted 328
7 SASI_Hs01_00049870 predicted 819
8 SASI_Hs01_00049871 predicted 321
9 SASI_Hs01_00049872 predicted 320
10 SASI_Hs01_00049873 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080619 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368660 predicted 576
2 SASI_Rn02_00368661 predicted 818
3 SASI_Rn02_00368662 predicted 1092
4 SASI_Rn02_00368663 predicted 404
5 SASI_Rn02_00368664 predicted 773
6 SASI_Rn02_00368665 predicted 897
7 SASI_Rn02_00368666 predicted 1049
8 SASI_Rn02_00368667 predicted 875
9 SASI_Rn02_00368668 predicted 264
10 SASI_Rn02_00368669 predicted 1036
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340856 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392030 predicted 323
2 SASI_Rn02_00392031 predicted 280
3 SASI_Rn02_00392032 predicted 398
4 SASI_Rn02_00392033 predicted 426
5 SASI_Rn02_00392034 predicted 515
6 SASI_Rn02_00392035 predicted 374
7 SASI_Rn02_00392036 predicted 272
8 SASI_Rn02_00392037 predicted 540
9 SASI_Rn02_00392038 predicted 336
10 SASI_Rn02_00392039 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019818 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199776 predicted 531
2 SASI_Mm01_00199777 predicted 399
3 SASI_Mm01_00199778 predicted 850
4 SASI_Mm01_00199779 predicted 825
5 SASI_Mm01_00199780 predicted 865
6 SASI_Mm01_00199781 predicted 579
7 SASI_Mm01_00199782 predicted 692
8 SASI_Mm02_00325098 predicted 362
9 SASI_Mm01_00199784 predicted 299
10 SASI_Mm02_00325099 predicted 883
11 SASI_Mm01_00199775 predicted 652
12 SASI_Mm01_00199783 predicted 702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013337
VALIDATED
TIMM22 MISSION shRNA Bacterial Glycerol Stock
translocase of inner mitochondrial membrane 22 homolog (yeast)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013337.1-568s1c1
Sequence:CCGGCGATTGATTATTACCTCCGGTCTCGAGACCGGAGGTAATAATCAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_013337.1-301s1c1
Sequence:CCGGGCTTTGACCCTAAGGATCCTTCTCGAGAAGGATCCTTAGGGTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013337.1-309s1c1
Sequence:CCGGCCTAAGGATCCTTACCGTACACTCGAGTGTACGGTAAGGATCCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013337.1-177s1c1
Sequence:CCGGGAGCAGAAGATGATCGAGAAGCTCGAGCTTCTCGATCATCTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013337.1-302s1c1
Sequence:CCGGCTTTGACCCTAAGGATCCTTACTCGAGTAAGGATCCTTAGGGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013337.1-454s1c1
Sequence:CCGGCAGACTTGAAGAACAGTGTCACTCGAGTGACACTGTTCTTCAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013337.1-348s1c1
Sequence:CCGGCTGAAAGAACATGGGCAGAGACTCGAGTCTCTGCCCATGTTCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013337.1-555s1c1
Sequence:CCGGGCTTTCTCTGCTGCGATTGATCTCGAGATCAATCGCAGCAGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_013337.1-244s1c1
Sequence:CCGGGATTTGTCTTAGGAGGTGCATCTCGAGATGCACCTCCTAAGACAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013337
VALIDATED
TIMM22 MISSION shRNA shRNA Plasmid DNA
translocase of inner mitochondrial membrane 22 homolog (yeast)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013337.1-568s1c1
Sequence:CCGGCGATTGATTATTACCTCCGGTCTCGAGACCGGAGGTAATAATCAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_013337.1-301s1c1
Sequence:CCGGGCTTTGACCCTAAGGATCCTTCTCGAGAAGGATCCTTAGGGTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013337.1-309s1c1
Sequence:CCGGCCTAAGGATCCTTACCGTACACTCGAGTGTACGGTAAGGATCCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013337.1-177s1c1
Sequence:CCGGGAGCAGAAGATGATCGAGAAGCTCGAGCTTCTCGATCATCTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013337.1-302s1c1
Sequence:CCGGCTTTGACCCTAAGGATCCTTACTCGAGTAAGGATCCTTAGGGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013337.1-454s1c1
Sequence:CCGGCAGACTTGAAGAACAGTGTCACTCGAGTGACACTGTTCTTCAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013337.1-348s1c1
Sequence:CCGGCTGAAAGAACATGGGCAGAGACTCGAGTCTCTGCCCATGTTCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013337.1-555s1c1
Sequence:CCGGGCTTTCTCTGCTGCGATTGATCTCGAGATCAATCGCAGCAGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_013337.1-244s1c1
Sequence:CCGGGATTTGTCTTAGGAGGTGCATCTCGAGATGCACCTCCTAAGACAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013337
VALIDATED
TIMM22 MISSION shRNA Lentiviral Transduction Particles
translocase of inner mitochondrial membrane 22 homolog (yeast)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013337.1-568s1c1
Sequence:CCGGCGATTGATTATTACCTCCGGTCTCGAGACCGGAGGTAATAATCAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_013337.1-301s1c1
Sequence:CCGGGCTTTGACCCTAAGGATCCTTCTCGAGAAGGATCCTTAGGGTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013337.1-309s1c1
Sequence:CCGGCCTAAGGATCCTTACCGTACACTCGAGTGTACGGTAAGGATCCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013337.1-177s1c1
Sequence:CCGGGAGCAGAAGATGATCGAGAAGCTCGAGCTTCTCGATCATCTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013337.1-302s1c1
Sequence:CCGGCTTTGACCCTAAGGATCCTTACTCGAGTAAGGATCCTTAGGGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013337.1-454s1c1
Sequence:CCGGCAGACTTGAAGAACAGTGTCACTCGAGTGACACTGTTCTTCAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013337.1-348s1c1
Sequence:CCGGCTGAAAGAACATGGGCAGAGACTCGAGTCTCTGCCCATGTTCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013337.1-555s1c1
Sequence:CCGGGCTTTCTCTGCTGCGATTGATCTCGAGATCAATCGCAGCAGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_013337.1-244s1c1
Sequence:CCGGGATTTGTCTTAGGAGGTGCATCTCGAGATGCACCTCCTAAGACAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019818
VALIDATED
TIMM22 MISSION shRNA Bacterial Glycerol Stock
translocase of inner mitochondrial membrane 22 homolog (yeast)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019818.2-2422s1c1
Sequence:CCGGGCTTCCTGTATTGTCTGTAAACTCGAGTTTACAGACAATACAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019818.2-77s1c1
Sequence:CCGGGCTCCGTTGCAGTACAGCCTTCTCGAGAAGGCTGTACTGCAACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019818.2-267s1c1
Sequence:CCGGGAGGCGCGTTTGGTATCTTTACTCGAGTAAAGATACCAAACGCGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019818.2-290s1c1
Sequence:CCGGGCTGGCATTGATACCAACGTACTCGAGTACGTTGGTATCAATGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019818.2-575s1c1
Sequence:CCGGGCTGCAATCGATTATTACCTACTCGAGTAGGTAATAATCGATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019818.3-1027s21c1
Sequence:CCGGTATGCCATCGAGGCAATTATGCTCGAGCATAATTGCCTCGATGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019818.3-282s21c1
Sequence:CCGGCTTTACTGCTGGCATTGATACCTCGAGGTATCAATGCCAGCAGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019818.3-569s21c1
Sequence:CCGGTCTCTGCTGCAATCGATTATTCTCGAGAATAATCGATTGCAGCAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019818.3-79s21c1
Sequence:CCGGCCGTTGCAGTACAGCCTTCTTCTCGAGAAGAAGGCTGTACTGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019818.3-433s21c1
Sequence:CCGGGAGTGTCTGGTAGAGTCTTACCTCGAGGTAAGACTCTACCAGACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019818
VALIDATED
TIMM22 MISSION shRNA shRNA Plasmid DNA
translocase of inner mitochondrial membrane 22 homolog (yeast)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019818.2-2422s1c1
Sequence:CCGGGCTTCCTGTATTGTCTGTAAACTCGAGTTTACAGACAATACAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019818.2-77s1c1
Sequence:CCGGGCTCCGTTGCAGTACAGCCTTCTCGAGAAGGCTGTACTGCAACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019818.2-267s1c1
Sequence:CCGGGAGGCGCGTTTGGTATCTTTACTCGAGTAAAGATACCAAACGCGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019818.2-290s1c1
Sequence:CCGGGCTGGCATTGATACCAACGTACTCGAGTACGTTGGTATCAATGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019818.2-575s1c1
Sequence:CCGGGCTGCAATCGATTATTACCTACTCGAGTAGGTAATAATCGATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019818.3-1027s21c1
Sequence:CCGGTATGCCATCGAGGCAATTATGCTCGAGCATAATTGCCTCGATGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019818.3-282s21c1
Sequence:CCGGCTTTACTGCTGGCATTGATACCTCGAGGTATCAATGCCAGCAGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019818.3-569s21c1
Sequence:CCGGTCTCTGCTGCAATCGATTATTCTCGAGAATAATCGATTGCAGCAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019818.3-79s21c1
Sequence:CCGGCCGTTGCAGTACAGCCTTCTTCTCGAGAAGAAGGCTGTACTGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019818.3-433s21c1
Sequence:CCGGGAGTGTCTGGTAGAGTCTTACCTCGAGGTAAGACTCTACCAGACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019818
VALIDATED
TIMM22 MISSION shRNA Lentiviral Transduction Particles
translocase of inner mitochondrial membrane 22 homolog (yeast)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019818.2-2422s1c1
Sequence:CCGGGCTTCCTGTATTGTCTGTAAACTCGAGTTTACAGACAATACAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019818.2-77s1c1
Sequence:CCGGGCTCCGTTGCAGTACAGCCTTCTCGAGAAGGCTGTACTGCAACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019818.2-267s1c1
Sequence:CCGGGAGGCGCGTTTGGTATCTTTACTCGAGTAAAGATACCAAACGCGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019818.2-290s1c1
Sequence:CCGGGCTGGCATTGATACCAACGTACTCGAGTACGTTGGTATCAATGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019818.2-575s1c1
Sequence:CCGGGCTGCAATCGATTATTACCTACTCGAGTAGGTAATAATCGATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019818.3-1027s21c1
Sequence:CCGGTATGCCATCGAGGCAATTATGCTCGAGCATAATTGCCTCGATGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019818.3-282s21c1
Sequence:CCGGCTTTACTGCTGGCATTGATACCTCGAGGTATCAATGCCAGCAGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019818.3-569s21c1
Sequence:CCGGTCTCTGCTGCAATCGATTATTCTCGAGAATAATCGATTGCAGCAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019818.3-79s21c1
Sequence:CCGGCCGTTGCAGTACAGCCTTCTTCTCGAGAAGAAGGCTGTACTGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019818.3-433s21c1
Sequence:CCGGGAGTGTCTGGTAGAGTCTTACCTCGAGGTAAGACTCTACCAGACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks