EMAIL THIS PAGE TO A FRIEND

TIMM23

translocase of inner mitochondrial membrane 23 homolog (yeast)

Synonyms: TIM23
UniProtKB ID: O14925, Q53FF8, Q5T1E6, Q6P5S5
Gene ID:
Human(100287932) Summary: The protein encoded by this gene is part of a complex located in the inner mitochondrial membrane that mediates the transport of transit peptide-containing proteins across the membrane. Multiple transcript variants, one protein-coding and others not protein-coding, have been found for this gene. [provided by RefSeq, Jul 2012]
Mouse(53600) translocase of inner mitochondrial membrane 23
Rat(54312) translocase of inner mitochondrial membrane 23 homolog (yeast)
Zebrafish(798429) translocase of inner mitochondrial membrane 23 homolog (yeast)
chicken(423616) translocase of inner mitochondrial membrane 23 homolog (yeast)
domestic cat(101094135) translocase of inner mitochondrial membrane 23 homolog (yeast)
dog(486776) translocase of inner mitochondrial membrane 23 homolog (yeast)
cow(509841) translocase of inner mitochondrial membrane 23 homolog (yeast)
sheep(101118849) translocase of inner mitochondrial membrane 23 homolog (yeast)
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301763 ANTI-TIMM23 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016897 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016897 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016897 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU093421 MISSION® esiRNA esiRNA targeting mouse Timm23 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019352 Rosetta Predictions rat pricing
NM_016897 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019352 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262356 predicted 260
2 SASI_Rn02_00262357 predicted 577
3 SASI_Rn01_00075361 predicted 471
4 SASI_Rn01_00075362 predicted 423
5 SASI_Rn01_00075364 predicted 810
6 SASI_Rn01_00075366 predicted 583
7 SASI_Rn01_00075368 predicted 549
8 SASI_Rn01_00075369 predicted 860
9 SASI_Rn02_00262358 predicted 865
10 SASI_Rn02_00262359 predicted 311
11 SASI_Rn01_00075360 predicted 844
12 SASI_Rn01_00075363 predicted 771
13 SASI_Rn01_00075365 predicted 795
14 SASI_Rn01_00075367 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016897 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080531 predicted 328
2 SASI_Mm01_00080533 predicted 604
3 SASI_Mm02_00323740 predicted 332
4 SASI_Mm02_00323741 predicted 282
5 SASI_Mm01_00080529 predicted 392
6 SASI_Mm01_00080530 predicted 446
7 SASI_Mm01_00080532 predicted 788
8 SASI_Mm01_00080534 predicted 881
9 SASI_Mm01_00080535 predicted 491
10 SASI_Mm01_00080536 predicted 681
11 SASI_Mm01_00080537 predicted 896
12 SASI_Mm01_00080538 predicted 615
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016897
TIMM23 MISSION shRNA Bacterial Glycerol Stock
translocase of inner mitochondrial membrane 23 homolog (yeast)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016897.3-215s21c1
Sequence:CCGGGGGTTACTCGAACGCTGATTTCTCGAGAAATCAGCGTTCGAGTAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016897.3-512s21c1
Sequence:CCGGAGGAGCACTTTGGGCTAATACCTCGAGGTATTAGCCCAAAGTGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016897.3-654s21c1
Sequence:CCGGACAGGTGGTCTTCGAGGAATACTCGAGTATTCCTCGAAGACCACCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114246    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016897.1-877s1c1
Sequence:CCGGGCTGTGACAAAGATCATGGATCTCGAGATCCATGATCTTTGTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016897.1-442s1c1
Sequence:CCGGGCCTGGTCCAAACCAAGAAATCTCGAGATTTCTTGGTTTGGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016897.1-405s1c1
Sequence:CCGGCGGTCTTCGTTTAGGATTGAACTCGAGTTCAATCCTAAACGAAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016897.1-686s1c1
Sequence:CCGGCCAGTCTCTATGCACTGTATACTCGAGTATACAGTGCATAGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016897.1-271s1c1
Sequence:CCGGCCACGCTATCTCGTTCAGGATCTCGAGATCCTGAACGAGATAGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016897
TIMM23 MISSION shRNA shRNA Plasmid DNA
translocase of inner mitochondrial membrane 23 homolog (yeast)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016897.3-215s21c1
Sequence:CCGGGGGTTACTCGAACGCTGATTTCTCGAGAAATCAGCGTTCGAGTAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016897.3-512s21c1
Sequence:CCGGAGGAGCACTTTGGGCTAATACCTCGAGGTATTAGCCCAAAGTGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016897.3-654s21c1
Sequence:CCGGACAGGTGGTCTTCGAGGAATACTCGAGTATTCCTCGAAGACCACCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114246    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016897.1-877s1c1
Sequence:CCGGGCTGTGACAAAGATCATGGATCTCGAGATCCATGATCTTTGTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016897.1-442s1c1
Sequence:CCGGGCCTGGTCCAAACCAAGAAATCTCGAGATTTCTTGGTTTGGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016897.1-405s1c1
Sequence:CCGGCGGTCTTCGTTTAGGATTGAACTCGAGTTCAATCCTAAACGAAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016897.1-686s1c1
Sequence:CCGGCCAGTCTCTATGCACTGTATACTCGAGTATACAGTGCATAGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016897.1-271s1c1
Sequence:CCGGCCACGCTATCTCGTTCAGGATCTCGAGATCCTGAACGAGATAGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016897
TIMM23 MISSION shRNA Lentiviral Transduction Particles
translocase of inner mitochondrial membrane 23 homolog (yeast)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016897.3-215s21c1
Sequence:CCGGGGGTTACTCGAACGCTGATTTCTCGAGAAATCAGCGTTCGAGTAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016897.3-512s21c1
Sequence:CCGGAGGAGCACTTTGGGCTAATACCTCGAGGTATTAGCCCAAAGTGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016897.3-654s21c1
Sequence:CCGGACAGGTGGTCTTCGAGGAATACTCGAGTATTCCTCGAAGACCACCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114246    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016897.1-877s1c1
Sequence:CCGGGCTGTGACAAAGATCATGGATCTCGAGATCCATGATCTTTGTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016897.1-442s1c1
Sequence:CCGGGCCTGGTCCAAACCAAGAAATCTCGAGATTTCTTGGTTTGGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016897.1-405s1c1
Sequence:CCGGCGGTCTTCGTTTAGGATTGAACTCGAGTTCAATCCTAAACGAAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016897.1-686s1c1
Sequence:CCGGCCAGTCTCTATGCACTGTATACTCGAGTATACAGTGCATAGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016897.1-271s1c1
Sequence:CCGGCCACGCTATCTCGTTCAGGATCTCGAGATCCTGAACGAGATAGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks