EMAIL THIS PAGE TO A FRIEND

TIMM44

translocase of inner mitochondrial membrane 44 homolog (yeast)

Synonyms: TIM44
UniProtKB ID: O43615, A8K0R9, D6W664, Q8N193
Gene ID:
Mouse(21856) translocase of inner mitochondrial membrane 44
Rat(29635) translocase of inner mitochondrial membrane 44 homolog (yeast)
Zebrafish(541380) translocase of inner mitochondrial membrane 44 homolog (yeast)
chicken(420053) translocase of inner mitochondrial membrane 44 homolog (yeast)
dog(485005) translocase of inner mitochondrial membrane 44 homolog (yeast)
domestic cat(101094654) translocase of inner mitochondrial membrane 44 homolog (yeast)
Horse(100066823) translocase of inner mitochondrial membrane 44 homolog (yeast)
domestic guinea pig(100732052) translocase of inner mitochondrial membrane 44 homolog (yeast)
naked mole-rat(101713213) translocase of inner mitochondrial membrane 44 homolog (yeast)
cow(528165) translocase of inner mitochondrial membrane 44 homolog (yeast)
sheep(101103567) translocase of inner mitochondrial membrane 44 homolog (yeast)
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011592 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011592 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011592 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006351 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006351 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006351 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006351 Rosetta Predictions human pricing
NM_017267 Rosetta Predictions rat pricing
NM_011592 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341392 predicted 1091
2 SASI_Hs01_00071943 predicted 865
3 SASI_Hs01_00071944 predicted 631
4 SASI_Hs01_00071946 predicted 1414
5 SASI_Hs01_00071948 predicted 1350
6 SASI_Hs02_00341393 predicted 764
7 SASI_Hs01_00071949 predicted 921
8 SASI_Hs01_00071950 predicted 833
9 SASI_Hs01_00071951 predicted 1411
10 SASI_Hs01_00071952 predicted 1180
11 SASI_Hs01_00071945 predicted 1007
12 SASI_Hs01_00071947 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017267 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090847 predicted 682
2 SASI_Rn01_00090848 predicted 949
3 SASI_Rn01_00090849 predicted 1434
4 SASI_Rn01_00090850 predicted 411
5 SASI_Rn01_00090851 predicted 407
6 SASI_Rn01_00090852 predicted 360
7 SASI_Rn01_00090853 predicted 342
8 SASI_Rn01_00090854 predicted 809
9 SASI_Rn01_00090855 predicted 656
10 SASI_Rn01_00090856 predicted 1347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011592 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054420 predicted 672
2 SASI_Mm01_00054421 predicted 407
3 SASI_Mm01_00054422 predicted 1220
4 SASI_Mm01_00054424 predicted 318
5 SASI_Mm01_00054426 predicted 938
6 SASI_Mm02_00320995 predicted 200
7 SASI_Mm01_00054428 predicted 800
8 SASI_Mm02_00320996 predicted 864
9 SASI_Mm01_00054429 predicted 670
10 SASI_Mm02_00320997 predicted 988
11 SASI_Mm01_00054423 predicted 379
12 SASI_Mm01_00054425 predicted 1427
13 SASI_Mm01_00054427 predicted 1439
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011592
VALIDATED
TIMM44 MISSION shRNA Bacterial Glycerol Stock
translocase of inner mitochondrial membrane 44 homolog (yeast)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011592.1-806s1c1
Sequence:CCGGTGAAAGTGACAATGTCCTCATCTCGAGATGAGGACATTGTCACTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011592.1-101s1c1
Sequence:CCGGCCATGGTTCAAGCTACCAGATCTCGAGATCTGGTAGCTTGAACCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011592.1-765s1c1
Sequence:CCGGGTTGTATTCAACCGCTTCTTTCTCGAGAAAGAAGCGGTTGAATACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011592.1-1435s1c1
Sequence:CCGGCCACATCTGATACAGCTGTAACTCGAGTTACAGCTGTATCAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011592.1-344s1c1
Sequence:CCGGGCGTACCAGTGAAGCAATAAACTCGAGTTTATTGCTTCACTGGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011592.2-762s21c1
Sequence:CCGGCAAAGATAACAACGTTGTATTCTCGAGAATACAACGTTGTTATCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011592.2-195s21c1
Sequence:CCGGTTTGTCAGGCTTGCTAGATAACTCGAGTTATCTAGCAAGCCTGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011592.2-113s21c1
Sequence:CCGGATGGTTCAAGCTACCAGATAACTCGAGTTATCTGGTAGCTTGAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011592.2-1424s21c1
Sequence:CCGGCAGACACACAGAGACACTTTGCTCGAGCAAAGTGTCTCTGTGTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011592.2-996s21c1
Sequence:CCGGCATCCTAGAGGCCATGATTTCCTCGAGGAAATCATGGCCTCTAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011592.2-1226s21c1
Sequence:CCGGACTCCAAAGGCGAGGTGTATGCTCGAGCATACACCTCGCCTTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011592
VALIDATED
TIMM44 MISSION shRNA shRNA Plasmid DNA
translocase of inner mitochondrial membrane 44 homolog (yeast)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011592.1-806s1c1
Sequence:CCGGTGAAAGTGACAATGTCCTCATCTCGAGATGAGGACATTGTCACTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011592.1-101s1c1
Sequence:CCGGCCATGGTTCAAGCTACCAGATCTCGAGATCTGGTAGCTTGAACCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011592.1-765s1c1
Sequence:CCGGGTTGTATTCAACCGCTTCTTTCTCGAGAAAGAAGCGGTTGAATACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011592.1-1435s1c1
Sequence:CCGGCCACATCTGATACAGCTGTAACTCGAGTTACAGCTGTATCAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011592.1-344s1c1
Sequence:CCGGGCGTACCAGTGAAGCAATAAACTCGAGTTTATTGCTTCACTGGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011592.2-762s21c1
Sequence:CCGGCAAAGATAACAACGTTGTATTCTCGAGAATACAACGTTGTTATCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011592.2-195s21c1
Sequence:CCGGTTTGTCAGGCTTGCTAGATAACTCGAGTTATCTAGCAAGCCTGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011592.2-113s21c1
Sequence:CCGGATGGTTCAAGCTACCAGATAACTCGAGTTATCTGGTAGCTTGAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011592.2-1424s21c1
Sequence:CCGGCAGACACACAGAGACACTTTGCTCGAGCAAAGTGTCTCTGTGTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011592.2-996s21c1
Sequence:CCGGCATCCTAGAGGCCATGATTTCCTCGAGGAAATCATGGCCTCTAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011592.2-1226s21c1
Sequence:CCGGACTCCAAAGGCGAGGTGTATGCTCGAGCATACACCTCGCCTTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011592
VALIDATED
TIMM44 MISSION shRNA Lentiviral Transduction Particles
translocase of inner mitochondrial membrane 44 homolog (yeast)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011592.1-806s1c1
Sequence:CCGGTGAAAGTGACAATGTCCTCATCTCGAGATGAGGACATTGTCACTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011592.1-101s1c1
Sequence:CCGGCCATGGTTCAAGCTACCAGATCTCGAGATCTGGTAGCTTGAACCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011592.1-765s1c1
Sequence:CCGGGTTGTATTCAACCGCTTCTTTCTCGAGAAAGAAGCGGTTGAATACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011592.1-1435s1c1
Sequence:CCGGCCACATCTGATACAGCTGTAACTCGAGTTACAGCTGTATCAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011592.1-344s1c1
Sequence:CCGGGCGTACCAGTGAAGCAATAAACTCGAGTTTATTGCTTCACTGGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011592.2-762s21c1
Sequence:CCGGCAAAGATAACAACGTTGTATTCTCGAGAATACAACGTTGTTATCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011592.2-195s21c1
Sequence:CCGGTTTGTCAGGCTTGCTAGATAACTCGAGTTATCTAGCAAGCCTGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011592.2-113s21c1
Sequence:CCGGATGGTTCAAGCTACCAGATAACTCGAGTTATCTGGTAGCTTGAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011592.2-1424s21c1
Sequence:CCGGCAGACACACAGAGACACTTTGCTCGAGCAAAGTGTCTCTGTGTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011592.2-996s21c1
Sequence:CCGGCATCCTAGAGGCCATGATTTCCTCGAGGAAATCATGGCCTCTAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011592.2-1226s21c1
Sequence:CCGGACTCCAAAGGCGAGGTGTATGCTCGAGCATACACCTCGCCTTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006351
VALIDATED
TIMM44 MISSION shRNA Bacterial Glycerol Stock
translocase of inner mitochondrial membrane 44 homolog (yeast)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006351.2-770s1c1
Sequence:CCGGCCGGTTCTTCGAGATGAAGATCTCGAGATCTTCATCTCGAAGAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006351.2-552s1c1
Sequence:CCGGGAGTCCGTGAAGAAGGAAATTCTCGAGAATTTCCTTCTTCACGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006351.2-648s1c1
Sequence:CCGGGATAAGTTCAAGGAGGAGAAACTCGAGTTTCTCCTCCTTGAACTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006351.2-737s1c1
Sequence:CCGGGAAGGACTTCAAGGAGAACAACTCGAGTTGTTCTCCTTGAAGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_006351.2-185s1c1
Sequence:CCGGCGGCTTGCTAGATAATGTCAACTCGAGTTGACATTATCTAGCAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_006351.2-134s1c1
Sequence:CCGGGCTGCCACTGTCCAAATCATACTCGAGTATGATTTGGACAGTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_006351.2-869s1c1
Sequence:CCGGCCTGTTCTCCAAGACAGAGATCTCGAGATCTCTGTCTTGGAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_006351.2-758s1c1
Sequence:CCGGCGTGGTGTTTAACCGGTTCTTCTCGAGAAGAACCGGTTAAACACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006351.3-1797s21c1
Sequence:CCGGACACAGGTCACACAGTGCCAACTCGAGTTGGCACTGTGTGACCTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006351.3-1606s21c1
Sequence:CCGGTCCAGACCTCTGGGAACAAGACTCGAGTCTTGTTCCCAGAGGTCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006351.3-1196s21c1
Sequence:CCGGTGGTGCTATGAAGCTACTTACCTCGAGGTAAGTAGCTTCATAGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006351.3-970s21c1
Sequence:CCGGCGAAAGCGACAACGCGTTCATCTCGAGATGAACGCGTTGTCGCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006351
VALIDATED
TIMM44 MISSION shRNA shRNA Plasmid DNA
translocase of inner mitochondrial membrane 44 homolog (yeast)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006351.2-770s1c1
Sequence:CCGGCCGGTTCTTCGAGATGAAGATCTCGAGATCTTCATCTCGAAGAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006351.2-552s1c1
Sequence:CCGGGAGTCCGTGAAGAAGGAAATTCTCGAGAATTTCCTTCTTCACGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006351.2-648s1c1
Sequence:CCGGGATAAGTTCAAGGAGGAGAAACTCGAGTTTCTCCTCCTTGAACTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006351.2-737s1c1
Sequence:CCGGGAAGGACTTCAAGGAGAACAACTCGAGTTGTTCTCCTTGAAGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_006351.2-185s1c1
Sequence:CCGGCGGCTTGCTAGATAATGTCAACTCGAGTTGACATTATCTAGCAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_006351.2-134s1c1
Sequence:CCGGGCTGCCACTGTCCAAATCATACTCGAGTATGATTTGGACAGTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_006351.2-869s1c1
Sequence:CCGGCCTGTTCTCCAAGACAGAGATCTCGAGATCTCTGTCTTGGAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_006351.2-758s1c1
Sequence:CCGGCGTGGTGTTTAACCGGTTCTTCTCGAGAAGAACCGGTTAAACACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006351.3-1797s21c1
Sequence:CCGGACACAGGTCACACAGTGCCAACTCGAGTTGGCACTGTGTGACCTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006351.3-1606s21c1
Sequence:CCGGTCCAGACCTCTGGGAACAAGACTCGAGTCTTGTTCCCAGAGGTCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006351.3-1196s21c1
Sequence:CCGGTGGTGCTATGAAGCTACTTACCTCGAGGTAAGTAGCTTCATAGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006351.3-970s21c1
Sequence:CCGGCGAAAGCGACAACGCGTTCATCTCGAGATGAACGCGTTGTCGCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006351
VALIDATED
TIMM44 MISSION shRNA Lentiviral Transduction Particles
translocase of inner mitochondrial membrane 44 homolog (yeast)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006351.2-770s1c1
Sequence:CCGGCCGGTTCTTCGAGATGAAGATCTCGAGATCTTCATCTCGAAGAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006351.2-552s1c1
Sequence:CCGGGAGTCCGTGAAGAAGGAAATTCTCGAGAATTTCCTTCTTCACGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006351.2-648s1c1
Sequence:CCGGGATAAGTTCAAGGAGGAGAAACTCGAGTTTCTCCTCCTTGAACTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006351.2-737s1c1
Sequence:CCGGGAAGGACTTCAAGGAGAACAACTCGAGTTGTTCTCCTTGAAGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_006351.2-185s1c1
Sequence:CCGGCGGCTTGCTAGATAATGTCAACTCGAGTTGACATTATCTAGCAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_006351.2-134s1c1
Sequence:CCGGGCTGCCACTGTCCAAATCATACTCGAGTATGATTTGGACAGTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_006351.2-869s1c1
Sequence:CCGGCCTGTTCTCCAAGACAGAGATCTCGAGATCTCTGTCTTGGAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_006351.2-758s1c1
Sequence:CCGGCGTGGTGTTTAACCGGTTCTTCTCGAGAAGAACCGGTTAAACACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006351.3-1797s21c1
Sequence:CCGGACACAGGTCACACAGTGCCAACTCGAGTTGGCACTGTGTGACCTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006351.3-1606s21c1
Sequence:CCGGTCCAGACCTCTGGGAACAAGACTCGAGTCTTGTTCCCAGAGGTCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006351.3-1196s21c1
Sequence:CCGGTGGTGCTATGAAGCTACTTACCTCGAGGTAAGTAGCTTCATAGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006351.3-970s21c1
Sequence:CCGGCGAAAGCGACAACGCGTTCATCTCGAGATGAACGCGTTGTCGCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks