EMAIL THIS PAGE TO A FRIEND

TIMM50

translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae)

Synonyms: TIM50 TIM50L
UniProtKB ID: Q3ZCQ8, Q6QA00, Q96FJ5, Q96GY2, Q9H370
Gene ID:
Mouse(66525) translocase of inner mitochondrial membrane 50
Rat(685725) translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae)
cow(505489) translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae)
sheep(101117188) translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae)
naked mole-rat(101725971) translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae)
domestic guinea pig(100714382) translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae)
Zebrafish(393638) translocase of inner mitochondrial membrane 50 homolog (yeast)
chicken(770413) translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae)
domestic cat(101095703) translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae)
dog(476461) translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae)
115 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025616 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025616 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025616 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001001563 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001563 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001563 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001563 Rosetta Predictions human pricing
XM_001065015 Rosetta Predictions rat pricing
NM_025616 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001563 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193882 predicted 863
2 SASI_Hs01_00193883 predicted 1114
3 SASI_Hs01_00193884 predicted 1125
4 SASI_Hs01_00193885 predicted 228
5 SASI_Hs01_00193886 predicted 697
6 SASI_Hs01_00193887 predicted 721
7 SASI_Hs01_00193888 predicted 1245
8 SASI_Hs01_00193889 predicted 1083
9 SASI_Hs01_00193891 predicted 749
10 SASI_Hs02_00303827 predicted 1104
11 SASI_Hs01_00193890 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065015 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312560 predicted 226
2 SASI_Rn02_00312561 predicted 87
3 SASI_Rn02_00312562 predicted 227
4 SASI_Rn02_00312563 predicted 139
5 SASI_Rn02_00312564 predicted 257
6 SASI_Rn02_00312565 predicted 192
7 SASI_Rn02_00312566 predicted 222
8 SASI_Rn02_00312567 predicted 223
9 SASI_Rn02_00312568 predicted 251
10 SASI_Rn02_00312569 predicted 142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025616 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160228 predicted 242
2 SASI_Mm01_00160229 predicted 605
3 SASI_Mm01_00160230 predicted 436
4 SASI_Mm01_00160231 predicted 563
5 SASI_Mm01_00160232 predicted 289
6 SASI_Mm01_00160234 predicted 339
7 SASI_Mm01_00160235 predicted 916
8 SASI_Mm01_00160236 predicted 864
9 SASI_Mm01_00160237 predicted 625
10 SASI_Mm02_00328655 predicted 383
11 SASI_Mm01_00160233 predicted 917
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025616
VALIDATED
TIMM50 MISSION shRNA Bacterial Glycerol Stock
translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025616.3-298s21c1
Sequence:CCGGGTACCAAGATTCCTGATGAATCTCGAGATTCATCAGGAATCTTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025616.3-612s21c1
Sequence:CCGGACTGCATTTCCACTCATTGATCTCGAGATCAATGAGTGGAAATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025616.3-249s21c1
Sequence:CCGGACTGTCAGCATCGTCTATATTCTCGAGAATATAGACGATGCTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025616.3-439s21c1
Sequence:CCGGCCTACTACCAGCCACCTTATACTCGAGTATAAGGTGGCTGGTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025616.3-352s21c1
Sequence:CCGGGCCGGACATACAAATACTTCACTCGAGTGAAGTATTTGTATGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025616.1-355s1c1
Sequence:CCGGCGGACATACAAATACTTCAAACTCGAGTTTGAAGTATTTGTATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025616.1-353s1c1
Sequence:CCGGGCCGGACATACAAATACTTCACTCGAGTGAAGTATTTGTATGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025616.1-299s1c1
Sequence:CCGGGTACCAAGATTCCTGATGAATCTCGAGATTCATCAGGAATCTTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025616.1-613s1c1
Sequence:CCGGACTGCATTTCCACTCATTGATCTCGAGATCAATGAGTGGAAATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025616.1-570s1c1
Sequence:CCGGCCCTCTGTATGAAATAGTCATCTCGAGATGACTATTTCATACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025616
VALIDATED
TIMM50 MISSION shRNA shRNA Plasmid DNA
translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025616.3-298s21c1
Sequence:CCGGGTACCAAGATTCCTGATGAATCTCGAGATTCATCAGGAATCTTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025616.3-612s21c1
Sequence:CCGGACTGCATTTCCACTCATTGATCTCGAGATCAATGAGTGGAAATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025616.3-249s21c1
Sequence:CCGGACTGTCAGCATCGTCTATATTCTCGAGAATATAGACGATGCTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025616.3-439s21c1
Sequence:CCGGCCTACTACCAGCCACCTTATACTCGAGTATAAGGTGGCTGGTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025616.3-352s21c1
Sequence:CCGGGCCGGACATACAAATACTTCACTCGAGTGAAGTATTTGTATGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025616.1-355s1c1
Sequence:CCGGCGGACATACAAATACTTCAAACTCGAGTTTGAAGTATTTGTATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025616.1-353s1c1
Sequence:CCGGGCCGGACATACAAATACTTCACTCGAGTGAAGTATTTGTATGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025616.1-299s1c1
Sequence:CCGGGTACCAAGATTCCTGATGAATCTCGAGATTCATCAGGAATCTTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025616.1-613s1c1
Sequence:CCGGACTGCATTTCCACTCATTGATCTCGAGATCAATGAGTGGAAATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025616.1-570s1c1
Sequence:CCGGCCCTCTGTATGAAATAGTCATCTCGAGATGACTATTTCATACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025616
VALIDATED
TIMM50 MISSION shRNA Lentiviral Transduction Particles
translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025616.3-298s21c1
Sequence:CCGGGTACCAAGATTCCTGATGAATCTCGAGATTCATCAGGAATCTTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025616.3-612s21c1
Sequence:CCGGACTGCATTTCCACTCATTGATCTCGAGATCAATGAGTGGAAATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025616.3-249s21c1
Sequence:CCGGACTGTCAGCATCGTCTATATTCTCGAGAATATAGACGATGCTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025616.3-439s21c1
Sequence:CCGGCCTACTACCAGCCACCTTATACTCGAGTATAAGGTGGCTGGTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025616.3-352s21c1
Sequence:CCGGGCCGGACATACAAATACTTCACTCGAGTGAAGTATTTGTATGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025616.1-355s1c1
Sequence:CCGGCGGACATACAAATACTTCAAACTCGAGTTTGAAGTATTTGTATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025616.1-353s1c1
Sequence:CCGGGCCGGACATACAAATACTTCACTCGAGTGAAGTATTTGTATGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025616.1-299s1c1
Sequence:CCGGGTACCAAGATTCCTGATGAATCTCGAGATTCATCAGGAATCTTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025616.1-613s1c1
Sequence:CCGGACTGCATTTCCACTCATTGATCTCGAGATCAATGAGTGGAAATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025616.1-570s1c1
Sequence:CCGGCCCTCTGTATGAAATAGTCATCTCGAGATGACTATTTCATACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001563
VALIDATED
TIMM50 MISSION shRNA Bacterial Glycerol Stock
translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001563.1-675s21c1
Sequence:CCGGGGACTGTGAGCGTCGTCTATACTCGAGTATAGACGACGCTCACAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001563.1-1741s21c1
Sequence:CCGGACCCTGGTCTCGGAATCTAAACTCGAGTTTAGATTCCGAGACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001563.1-781s21c1
Sequence:CCGGCCGGACATACAAATATTTCAACTCGAGTTGAAATATTTGTATGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001563.1-1125s21c1
Sequence:CCGGGACACCATGTAAAGGATATTTCTCGAGAAATATCCTTTACATGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001563.1-1288s21c1
Sequence:CCGGCCTCAAGACCATTGCACTGAACTCGAGTTCAGTGCAATGGTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001563.1-2222s1c1
Sequence:CCGGGCTACCATACCCAGCTAATTTCTCGAGAAATTAGCTGGGTATGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001563.1-1125s1c1
Sequence:CCGGGACACCATGTAAAGGATATTTCTCGAGAAATATCCTTTACATGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001563.1-1368s1c1
Sequence:CCGGCGGCTTTCAAACAGCGGCAAACTCGAGTTTGCCGCTGTTTGAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001563.1-781s1c1
Sequence:CCGGCCGGACATACAAATATTTCAACTCGAGTTGAAATATTTGTATGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001563.1-1288s1c1
Sequence:CCGGCCTCAAGACCATTGCACTGAACTCGAGTTCAGTGCAATGGTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001563
VALIDATED
TIMM50 MISSION shRNA shRNA Plasmid DNA
translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001563.1-675s21c1
Sequence:CCGGGGACTGTGAGCGTCGTCTATACTCGAGTATAGACGACGCTCACAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001563.1-1741s21c1
Sequence:CCGGACCCTGGTCTCGGAATCTAAACTCGAGTTTAGATTCCGAGACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001563.1-781s21c1
Sequence:CCGGCCGGACATACAAATATTTCAACTCGAGTTGAAATATTTGTATGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001563.1-1125s21c1
Sequence:CCGGGACACCATGTAAAGGATATTTCTCGAGAAATATCCTTTACATGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001563.1-1288s21c1
Sequence:CCGGCCTCAAGACCATTGCACTGAACTCGAGTTCAGTGCAATGGTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001563.1-2222s1c1
Sequence:CCGGGCTACCATACCCAGCTAATTTCTCGAGAAATTAGCTGGGTATGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001563.1-1125s1c1
Sequence:CCGGGACACCATGTAAAGGATATTTCTCGAGAAATATCCTTTACATGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001563.1-1368s1c1
Sequence:CCGGCGGCTTTCAAACAGCGGCAAACTCGAGTTTGCCGCTGTTTGAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001563.1-781s1c1
Sequence:CCGGCCGGACATACAAATATTTCAACTCGAGTTGAAATATTTGTATGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001563.1-1288s1c1
Sequence:CCGGCCTCAAGACCATTGCACTGAACTCGAGTTCAGTGCAATGGTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001563
VALIDATED
TIMM50 MISSION shRNA Lentiviral Transduction Particles
translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001563.1-675s21c1
Sequence:CCGGGGACTGTGAGCGTCGTCTATACTCGAGTATAGACGACGCTCACAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001563.1-1741s21c1
Sequence:CCGGACCCTGGTCTCGGAATCTAAACTCGAGTTTAGATTCCGAGACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001563.1-781s21c1
Sequence:CCGGCCGGACATACAAATATTTCAACTCGAGTTGAAATATTTGTATGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001563.1-1125s21c1
Sequence:CCGGGACACCATGTAAAGGATATTTCTCGAGAAATATCCTTTACATGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001563.1-1288s21c1
Sequence:CCGGCCTCAAGACCATTGCACTGAACTCGAGTTCAGTGCAATGGTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001563.1-2222s1c1
Sequence:CCGGGCTACCATACCCAGCTAATTTCTCGAGAAATTAGCTGGGTATGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001563.1-1125s1c1
Sequence:CCGGGACACCATGTAAAGGATATTTCTCGAGAAATATCCTTTACATGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001563.1-1368s1c1
Sequence:CCGGCGGCTTTCAAACAGCGGCAAACTCGAGTTTGCCGCTGTTTGAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001563.1-781s1c1
Sequence:CCGGCCGGACATACAAATATTTCAACTCGAGTTGAAATATTTGTATGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001563.1-1288s1c1
Sequence:CCGGCCTCAAGACCATTGCACTGAACTCGAGTTCAGTGCAATGGTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks