EMAIL THIS PAGE TO A FRIEND

TIMM8A

translocase of inner mitochondrial membrane 8 homolog A (yeast)

Synonyms: DDP DDP1 DFN1 MTS TIM8
UniProtKB ID: O60220, B2R5A6, Q6IRW6
Gene ID:
Human(1678) Summary: This translocase is involved in the import and insertion of hydrophobic membrane proteins from the cytoplasm into the mitochondrial inner membrane. The gene is mutated in Mohr-Tranebjaerg syndrome/Deafness Dystonia Syndrome (MTS/DDS) and it is postulated that MTS/DDS is a mitochondrial disease caused by a defective mitochondrial protein import system. Defects in this gene also cause Jensen syndrome; an X-linked disease with opticoacoustic nerve atrophy and muscle weakness. This protein, along with TIMM13, forms a 70 kDa heterohexamer. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Mar 2009]
Zebrafish(445243) translocase of inner mitochondrial membrane 8 homolog A (yeast)
domestic cat(101087820) translocase of inner mitochondrial membrane 8 homolog A (yeast)
dog(480986) translocase of inner mitochondrial membrane 8 homolog A (yeast)
chicken(422190) translocase of inner mitochondrial membrane 8 homolog A (yeast)
domestic guinea pig(100715801) translocase of inner mitochondrial membrane 8 homolog A (yeast)
naked mole-rat(101715600) translocase of inner mitochondrial membrane 8 homolog A (yeast)
cow(515109) translocase of inner mitochondrial membrane 8 homolog A (yeast)
sheep(101105475) translocase of inner mitochondrial membrane 8 homolog A (yeast)
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004085 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004085 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004085 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144971 MISSION® esiRNA esiRNA human TIMM8A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004085 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004085 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091125 predicted 801
2 SASI_Hs01_00091126 predicted 789
3 SASI_Hs01_00091127 predicted 820
4 SASI_Hs01_00091128 predicted 700
5 SASI_Hs01_00091129 predicted 785
6 SASI_Hs01_00091130 predicted 815
7 SASI_Hs01_00091131 predicted 747
8 SASI_Hs01_00091132 predicted 760
9 SASI_Hs01_00091133 predicted 662
10 SASI_Hs01_00091134 predicted 660
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004085
VALIDATED
TIMM8A MISSION shRNA Bacterial Glycerol Stock
translocase of inner mitochondrial membrane 8 homolog A (yeast)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004085.2-242s1c1
Sequence:CCGGCTTCATTGATACAAGCCAGTTCTCGAGAACTGGCTTGTATCAATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004085.2-257s1c1
Sequence:CCGGCCAGTTCATCTTGAATCGACTCTCGAGAGTCGATTCAAGATGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004085.2-92s1c1
Sequence:CCGGGCAGCATTTCATCGAGGTAGACTCGAGTCTACCTCGATGAAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004085.2-152s1c1
Sequence:CCGGGACTGAACTTTGTTGGGAGAACTCGAGTTCTCCCAACAAAGTTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004085.2-286s1c1
Sequence:CCGGCCCAGAAATCCAAGCCAGTTTCTCGAGAAACTGGCTTGGATTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_004085.2-229s21c1
Sequence:CCGGACTGCGTTGAGCGCTTCATTGCTCGAGCAATGAAGCGCTCAACGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004085.2-487s21c1
Sequence:CCGGTGTGAAGCTTAAGGGTCATATCTCGAGATATGACCCTTAAGCTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004085.2-81s21c1
Sequence:CCGGGACCCACAGTTGCAGCATTTCCTCGAGGAAATGCTGCAACTGTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004085.2-321s21c1
Sequence:CCGGTCTGACTGATCTCAGCATTACCTCGAGGTAATGCTGAGATCAGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004085.2-143s21c1
Sequence:CCGGGCACCAGATGACTGAACTTTGCTCGAGCAAAGTTCAGTCATCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004085
VALIDATED
TIMM8A MISSION shRNA shRNA Plasmid DNA
translocase of inner mitochondrial membrane 8 homolog A (yeast)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004085.2-242s1c1
Sequence:CCGGCTTCATTGATACAAGCCAGTTCTCGAGAACTGGCTTGTATCAATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004085.2-257s1c1
Sequence:CCGGCCAGTTCATCTTGAATCGACTCTCGAGAGTCGATTCAAGATGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004085.2-92s1c1
Sequence:CCGGGCAGCATTTCATCGAGGTAGACTCGAGTCTACCTCGATGAAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004085.2-152s1c1
Sequence:CCGGGACTGAACTTTGTTGGGAGAACTCGAGTTCTCCCAACAAAGTTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004085.2-286s1c1
Sequence:CCGGCCCAGAAATCCAAGCCAGTTTCTCGAGAAACTGGCTTGGATTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_004085.2-229s21c1
Sequence:CCGGACTGCGTTGAGCGCTTCATTGCTCGAGCAATGAAGCGCTCAACGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004085.2-487s21c1
Sequence:CCGGTGTGAAGCTTAAGGGTCATATCTCGAGATATGACCCTTAAGCTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004085.2-81s21c1
Sequence:CCGGGACCCACAGTTGCAGCATTTCCTCGAGGAAATGCTGCAACTGTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004085.2-321s21c1
Sequence:CCGGTCTGACTGATCTCAGCATTACCTCGAGGTAATGCTGAGATCAGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004085.2-143s21c1
Sequence:CCGGGCACCAGATGACTGAACTTTGCTCGAGCAAAGTTCAGTCATCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004085
VALIDATED
TIMM8A MISSION shRNA Lentiviral Transduction Particles
translocase of inner mitochondrial membrane 8 homolog A (yeast)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004085.2-242s1c1
Sequence:CCGGCTTCATTGATACAAGCCAGTTCTCGAGAACTGGCTTGTATCAATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004085.2-257s1c1
Sequence:CCGGCCAGTTCATCTTGAATCGACTCTCGAGAGTCGATTCAAGATGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004085.2-92s1c1
Sequence:CCGGGCAGCATTTCATCGAGGTAGACTCGAGTCTACCTCGATGAAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004085.2-152s1c1
Sequence:CCGGGACTGAACTTTGTTGGGAGAACTCGAGTTCTCCCAACAAAGTTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004085.2-286s1c1
Sequence:CCGGCCCAGAAATCCAAGCCAGTTTCTCGAGAAACTGGCTTGGATTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_004085.2-229s21c1
Sequence:CCGGACTGCGTTGAGCGCTTCATTGCTCGAGCAATGAAGCGCTCAACGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004085.2-487s21c1
Sequence:CCGGTGTGAAGCTTAAGGGTCATATCTCGAGATATGACCCTTAAGCTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004085.2-81s21c1
Sequence:CCGGGACCCACAGTTGCAGCATTTCCTCGAGGAAATGCTGCAACTGTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004085.2-321s21c1
Sequence:CCGGTCTGACTGATCTCAGCATTACCTCGAGGTAATGCTGAGATCAGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004085.2-143s21c1
Sequence:CCGGGCACCAGATGACTGAACTTTGCTCGAGCAAAGTTCAGTCATCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks