EMAIL THIS PAGE TO A FRIEND

TIMM8B

translocase of inner mitochondrial membrane 8 homolog B (yeast)

Synonyms: DDP2 TIM8B
UniProtKB ID: Q9Y5J9, B0YJA5, Q3KQS9, Q9UN04
Gene ID:
Human(26521) Summary: This gene encodes a member of a well-conserved family of proteins with similarity to yeast Tim mitochondrial import proteins. This gene is encoded by a nuclear gene and is transported into the intermembrane space of the mitochondrion. When formed into complexes, these proteins guide membrane-spanning proteins across the mitochondrial intermembrane space before they are added into the mitochondrial inner membrane. This gene is adjacent to succinate dehydrogenase, subunit D (SDHD), in which mutations have been found in affected members of families with hereditary paraganglioma.[provided by RefSeq, Aug 2009]
Mouse(30057) translocase of inner mitochondrial membrane 8B
Rat(64372) translocase of inner mitochondrial membrane 8 homolog b (yeast)
Zebrafish(793663) translocase of inner mitochondrial membrane 8 homolog B (yeast)
dog(611348) translocase of inner mitochondrial membrane 8 homolog B (yeast)
domestic cat(101095041) translocase of inner mitochondrial membrane 8 homolog B (yeast)
cow(618131) translocase of inner mitochondrial membrane 8 homolog B (yeast)
sheep(101111742) translocase of inner mitochondrial membrane 8 homolog B (yeast)
domestic guinea pig(100735011) translocase of inner mitochondrial membrane 8 homolog B (yeast)
naked mole-rat(101701661) translocase of inner mitochondrial membrane 8 homolog B (yeast)
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013897 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013897 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013897 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012459 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012459 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012459 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012459 Rosetta Predictions human pricing
NM_022541 Rosetta Predictions rat pricing
NM_013897 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074185 predicted 287
2 SASI_Hs01_00074186 predicted 293
3 SASI_Hs01_00074187 predicted 150
4 SASI_Hs01_00074188 predicted 146
5 SASI_Hs01_00074189 predicted 31
6 SASI_Hs01_00074191 predicted 289
7 SASI_Hs02_00344368 predicted 67
8 SASI_Hs01_00074183 predicted 370
9 SASI_Hs01_00074184 predicted 344
10 SASI_Hs01_00074190 predicted 352
11 SASI_Hs01_00074192 predicted 114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022541 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059795 predicted 206
2 SASI_Rn01_00059796 predicted 249
3 SASI_Rn01_00059797 predicted 255
4 SASI_Rn01_00059798 predicted 261
5 SASI_Rn01_00059799 predicted 254
6 SASI_Rn01_00059800 predicted 92
7 SASI_Rn01_00059801 predicted 148
8 SASI_Rn01_00059802 predicted 370
9 SASI_Rn01_00059803 predicted 343
10 SASI_Rn01_00059804 predicted 61
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013897 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174790 predicted 227
2 SASI_Mm01_00174791 predicted 215
3 SASI_Mm01_00174794 predicted 304
4 SASI_Mm02_00322954 predicted 290
5 SASI_Mm02_00322955 predicted 211
6 SASI_Mm02_00322956 predicted 294
7 SASI_Mm02_00322957 predicted 301
8 SASI_Mm02_00322958 predicted 303
9 SASI_Mm02_00322959 predicted 303
10 SASI_Mm02_00322960 predicted 212
11 SASI_Mm01_00174789 predicted 345
12 SASI_Mm01_00174792 predicted 373
13 SASI_Mm01_00174793 predicted 422
14 SASI_Mm01_00174795 predicted 406
15 SASI_Mm01_00174796 predicted 341
16 SASI_Mm01_00174797 predicted 382
17 SASI_Mm01_00174798 predicted 393
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013897
VALIDATED
TIMM8B MISSION shRNA Bacterial Glycerol Stock
translocase of inner mitochondrial membrane 8 homolog B (yeast)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013897.2-140s21c1
Sequence:CCGGGTGCATCACTTCATGGAACTACTCGAGTAGTTCCATGAAGTGATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013897.2-109s21c1
Sequence:CCGGCGAACAGCAGAAGGCGCAATTCTCGAGAATTGCGCCTTCTGCTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013897.2-239s21c1
Sequence:CCGGCGCTTCATTGACACTACTCTTCTCGAGAAGAGTAGTGTCAATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013897.2-487s21c1
Sequence:CCGGCCAACTTGTATCACACCAGTTCTCGAGAACTGGTGTGATACAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013897.1-129s1c1
Sequence:CCGGGTGCATCACTTCATGGAACTACTCGAGTAGTTCCATGAAGTGATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126834    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013897.1-476s1c1
Sequence:CCGGCCAACTTGTATCACACCAGTTCTCGAGAACTGGTGTGATACAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013897.1-233s1c1
Sequence:CCGGCATTGACACTACTCTTGCCATCTCGAGATGGCAAGAGTAGTGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013897.1-98s1c1
Sequence:CCGGCGAACAGCAGAAGGCGCAATTCTCGAGAATTGCGCCTTCTGCTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013897.1-228s1c1
Sequence:CCGGCGCTTCATTGACACTACTCTTCTCGAGAAGAGTAGTGTCAATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013897
VALIDATED
TIMM8B MISSION shRNA shRNA Plasmid DNA
translocase of inner mitochondrial membrane 8 homolog B (yeast)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013897.2-140s21c1
Sequence:CCGGGTGCATCACTTCATGGAACTACTCGAGTAGTTCCATGAAGTGATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013897.2-109s21c1
Sequence:CCGGCGAACAGCAGAAGGCGCAATTCTCGAGAATTGCGCCTTCTGCTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013897.2-239s21c1
Sequence:CCGGCGCTTCATTGACACTACTCTTCTCGAGAAGAGTAGTGTCAATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013897.2-487s21c1
Sequence:CCGGCCAACTTGTATCACACCAGTTCTCGAGAACTGGTGTGATACAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013897.1-129s1c1
Sequence:CCGGGTGCATCACTTCATGGAACTACTCGAGTAGTTCCATGAAGTGATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126834    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013897.1-476s1c1
Sequence:CCGGCCAACTTGTATCACACCAGTTCTCGAGAACTGGTGTGATACAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013897.1-233s1c1
Sequence:CCGGCATTGACACTACTCTTGCCATCTCGAGATGGCAAGAGTAGTGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013897.1-98s1c1
Sequence:CCGGCGAACAGCAGAAGGCGCAATTCTCGAGAATTGCGCCTTCTGCTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013897.1-228s1c1
Sequence:CCGGCGCTTCATTGACACTACTCTTCTCGAGAAGAGTAGTGTCAATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013897
VALIDATED
TIMM8B MISSION shRNA Lentiviral Transduction Particles
translocase of inner mitochondrial membrane 8 homolog B (yeast)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013897.2-140s21c1
Sequence:CCGGGTGCATCACTTCATGGAACTACTCGAGTAGTTCCATGAAGTGATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013897.2-109s21c1
Sequence:CCGGCGAACAGCAGAAGGCGCAATTCTCGAGAATTGCGCCTTCTGCTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013897.2-239s21c1
Sequence:CCGGCGCTTCATTGACACTACTCTTCTCGAGAAGAGTAGTGTCAATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013897.2-487s21c1
Sequence:CCGGCCAACTTGTATCACACCAGTTCTCGAGAACTGGTGTGATACAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013897.1-129s1c1
Sequence:CCGGGTGCATCACTTCATGGAACTACTCGAGTAGTTCCATGAAGTGATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126834    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013897.1-476s1c1
Sequence:CCGGCCAACTTGTATCACACCAGTTCTCGAGAACTGGTGTGATACAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013897.1-233s1c1
Sequence:CCGGCATTGACACTACTCTTGCCATCTCGAGATGGCAAGAGTAGTGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013897.1-98s1c1
Sequence:CCGGCGAACAGCAGAAGGCGCAATTCTCGAGAATTGCGCCTTCTGCTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013897.1-228s1c1
Sequence:CCGGCGCTTCATTGACACTACTCTTCTCGAGAAGAGTAGTGTCAATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012459
VALIDATED
TIMM8B MISSION shRNA Bacterial Glycerol Stock
translocase of inner mitochondrial membrane 8 homolog B (yeast)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012459.1-100s21c1
Sequence:CCGGCATCACTTCATGGAGTTATGTCTCGAGACATAACTCCATGAAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012459.1-201s21c1
Sequence:CCGGCATTGACACCACTCTTGCCATCTCGAGATGGCAAGAGTGGTGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012459.1-235s21c1
Sequence:CCGGGCCCAGATTGTACAGAAAGGACTCGAGTCCTTTCTGTACAATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_012459.1-201s1c1
Sequence:CCGGCATTGACACCACTCTTGCCATCTCGAGATGGCAAGAGTGGTGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012459.1-82s1c1
Sequence:CCGGCAGTTTACTGCACAGGTGCATCTCGAGATGCACCTGTGCAGTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012459.1-188s1c1
Sequence:CCGGGTGTAGACCGCTTCATTGACACTCGAGTGTCAATGAAGCGGTCTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012459.1-235s1c1
Sequence:CCGGGCCCAGATTGTACAGAAAGGACTCGAGTCCTTTCTGTACAATCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012459.1-240s1c1
Sequence:CCGGGATTGTACAGAAAGGAGGGCACTCGAGTGCCCTCCTTTCTGTACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158341    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012459.1-273s1c1
Sequence:CCGGCCAGGAGAATGACAGAAGCAACTCGAGTTGCTTCTGTCATTCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012459.1-196s1c1
Sequence:CCGGCGCTTCATTGACACCACTCTTCTCGAGAAGAGTGGTGTCAATGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_012459.1-231s1c1
Sequence:CCGGGTTTGCCCAGATTGTACAGAACTCGAGTTCTGTACAATCTGGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012459.1-100s1c1
Sequence:CCGGCATCACTTCATGGAGTTATGTCTCGAGACATAACTCCATGAAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012459
VALIDATED
TIMM8B MISSION shRNA shRNA Plasmid DNA
translocase of inner mitochondrial membrane 8 homolog B (yeast)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012459.1-100s21c1
Sequence:CCGGCATCACTTCATGGAGTTATGTCTCGAGACATAACTCCATGAAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012459.1-201s21c1
Sequence:CCGGCATTGACACCACTCTTGCCATCTCGAGATGGCAAGAGTGGTGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012459.1-235s21c1
Sequence:CCGGGCCCAGATTGTACAGAAAGGACTCGAGTCCTTTCTGTACAATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_012459.1-201s1c1
Sequence:CCGGCATTGACACCACTCTTGCCATCTCGAGATGGCAAGAGTGGTGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012459.1-82s1c1
Sequence:CCGGCAGTTTACTGCACAGGTGCATCTCGAGATGCACCTGTGCAGTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012459.1-188s1c1
Sequence:CCGGGTGTAGACCGCTTCATTGACACTCGAGTGTCAATGAAGCGGTCTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012459.1-235s1c1
Sequence:CCGGGCCCAGATTGTACAGAAAGGACTCGAGTCCTTTCTGTACAATCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012459.1-240s1c1
Sequence:CCGGGATTGTACAGAAAGGAGGGCACTCGAGTGCCCTCCTTTCTGTACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158341    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012459.1-273s1c1
Sequence:CCGGCCAGGAGAATGACAGAAGCAACTCGAGTTGCTTCTGTCATTCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012459.1-196s1c1
Sequence:CCGGCGCTTCATTGACACCACTCTTCTCGAGAAGAGTGGTGTCAATGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_012459.1-231s1c1
Sequence:CCGGGTTTGCCCAGATTGTACAGAACTCGAGTTCTGTACAATCTGGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012459.1-100s1c1
Sequence:CCGGCATCACTTCATGGAGTTATGTCTCGAGACATAACTCCATGAAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012459
VALIDATED
TIMM8B MISSION shRNA Lentiviral Transduction Particles
translocase of inner mitochondrial membrane 8 homolog B (yeast)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012459.1-100s21c1
Sequence:CCGGCATCACTTCATGGAGTTATGTCTCGAGACATAACTCCATGAAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012459.1-201s21c1
Sequence:CCGGCATTGACACCACTCTTGCCATCTCGAGATGGCAAGAGTGGTGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012459.1-235s21c1
Sequence:CCGGGCCCAGATTGTACAGAAAGGACTCGAGTCCTTTCTGTACAATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_012459.1-201s1c1
Sequence:CCGGCATTGACACCACTCTTGCCATCTCGAGATGGCAAGAGTGGTGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012459.1-82s1c1
Sequence:CCGGCAGTTTACTGCACAGGTGCATCTCGAGATGCACCTGTGCAGTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012459.1-188s1c1
Sequence:CCGGGTGTAGACCGCTTCATTGACACTCGAGTGTCAATGAAGCGGTCTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012459.1-235s1c1
Sequence:CCGGGCCCAGATTGTACAGAAAGGACTCGAGTCCTTTCTGTACAATCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012459.1-240s1c1
Sequence:CCGGGATTGTACAGAAAGGAGGGCACTCGAGTGCCCTCCTTTCTGTACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158341    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012459.1-273s1c1
Sequence:CCGGCCAGGAGAATGACAGAAGCAACTCGAGTTGCTTCTGTCATTCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012459.1-196s1c1
Sequence:CCGGCGCTTCATTGACACCACTCTTCTCGAGAAGAGTGGTGTCAATGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_012459.1-231s1c1
Sequence:CCGGGTTTGCCCAGATTGTACAGAACTCGAGTTCTGTACAATCTGGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012459.1-100s1c1
Sequence:CCGGCATCACTTCATGGAGTTATGTCTCGAGACATAACTCCATGAAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks