EMAIL THIS PAGE TO A FRIEND

TIMM9

translocase of inner mitochondrial membrane 9 homolog (yeast)

Synonyms: TIM9 TIM9A
UniProtKB ID: Q9Y5J7, B2R584
Gene ID:
Human(26520) Summary: TIMM9 belongs to a family of evolutionarily conserved proteins that are organized in heterooligomeric complexes in the mitochondrial intermembrane space. These proteins mediate the import and insertion of hydrophobic membrane proteins into the mitochondrial inner membrane.[supplied by OMIM, Apr 2004]
Mouse(30056) translocase of inner mitochondrial membrane 9
Rat(171139) translocase of inner mitochondrial membrane 9 homolog (yeast)
Zebrafish(282678) translocase of inner mitochondrial membrane 9 homolog
dog(609619) translocase of inner mitochondrial membrane 9 homolog (yeast)
chicken(100859762) translocase of inner mitochondrial membrane 9 homolog (yeast)
domestic cat(101096487) translocase of inner mitochondrial membrane 9 homolog (yeast)
naked mole-rat(101706496) translocase of inner mitochondrial membrane 9 homolog (yeast)
domestic guinea pig(100729375) translocase of inner mitochondrial membrane 9 homolog (yeast)
cow(521073) translocase of inner mitochondrial membrane 9 homolog (yeast)
sheep(101123381) translocase of inner mitochondrial membrane 9 homolog (yeast)
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012460 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012460 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012460 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001024853 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024853 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024853 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012460 Rosetta Predictions human pricing
XM_001072892 Rosetta Predictions rat pricing
XM_001080501 Rosetta Predictions rat pricing
NM_001024853 Rosetta Predictions mouse pricing
NM_001024854 Rosetta Predictions mouse pricing
NM_013896 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087080 predicted 614
2 SASI_Hs01_00087081 predicted 802
3 SASI_Hs01_00087082 predicted 785
4 SASI_Hs01_00087083 predicted 807
5 SASI_Hs01_00087084 predicted 616
6 SASI_Hs01_00087085 predicted 804
7 SASI_Hs02_00344369 predicted 731
8 SASI_Hs01_00087086 predicted 619
9 SASI_Hs01_00087087 predicted 750
10 SASI_Hs01_00087089 predicted 793
11 SASI_Hs01_00087088 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072892 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00340823 predicted 290
2 SASI_Rn02_00340824 predicted 337
3 SASI_Rn02_00340825 predicted 517
4 SASI_Rn02_00340826 predicted 513
5 SASI_Rn02_00340827 predicted 266
6 SASI_Rn02_00340828 predicted 203
7 SASI_Rn02_00340829 predicted 541
8 SASI_Rn02_00340830 predicted 427
9 SASI_Rn02_00340831 predicted 290
10 SASI_Rn02_00340832 predicted 196
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080501 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368181 predicted 287
2 SASI_Rn02_00368182 predicted 332
3 SASI_Rn02_00368183 predicted 512
4 SASI_Rn02_00368184 predicted 512
5 SASI_Rn02_00368185 predicted 264
6 SASI_Rn02_00368186 predicted 203
7 SASI_Rn02_00368187 predicted 538
8 SASI_Rn02_00368188 predicted 421
9 SASI_Rn02_00368189 predicted 292
10 SASI_Rn02_00368190 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024853 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021013 predicted 510
2 SASI_Mm01_00021014 predicted 518
3 SASI_Mm01_00021015 predicted 514
4 SASI_Mm01_00021016 predicted 522
5 SASI_Mm01_00021017 predicted 611
6 SASI_Mm01_00021018 predicted 530
7 SASI_Mm01_00021019 predicted 691
8 SASI_Mm01_00021020 predicted 699
9 SASI_Mm01_00021021 predicted 530
10 SASI_Mm02_00287730 predicted 692
11 SASI_Mm01_00021012 predicted 704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024854 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176350 predicted 320
2 SASI_Mm01_00176351 predicted 334
3 SASI_Mm01_00176352 predicted 335
4 SASI_Mm01_00176353 predicted 332
5 SASI_Mm01_00176354 predicted 425
6 SASI_Mm01_00176355 predicted 345
7 SASI_Mm01_00176356 predicted 512
8 SASI_Mm01_00176357 predicted 508
9 SASI_Mm01_00176358 predicted 350
10 SASI_Mm02_00287731 predicted 510
11 SASI_Mm01_00176349 predicted 519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013896 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089006 predicted 549
2 SASI_Mm01_00089007 predicted 553
3 SASI_Mm01_00089008 predicted 558
4 SASI_Mm01_00089009 predicted 554
5 SASI_Mm01_00089010 predicted 652
6 SASI_Mm01_00089011 predicted 567
7 SASI_Mm01_00089012 predicted 726
8 SASI_Mm01_00089013 predicted 732
9 SASI_Mm01_00089014 predicted 571
10 SASI_Mm02_00322953 predicted 734
11 SASI_Mm01_00089005 predicted 734
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012460
VALIDATED
TIMM9 MISSION shRNA Bacterial Glycerol Stock
translocase of inner mitochondrial membrane 9 homolog (yeast)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153536    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_012460.2-795s1c1
Sequence:CCGGCCATGTTCAACCATCTGTCATCTCGAGATGACAGATGGTTGAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012460.2-628s1c1
Sequence:CCGGCAGGAATATCATATTCAGCAGCTCGAGCTGCTGAATATGATATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012460.2-489s1c1
Sequence:CCGGCAATAAACTTACAGAGACCTGCTCGAGCAGGTCTCTGTAAGTTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012460.2-529s1c1
Sequence:CCGGGACTTCACAACAAGAGAAGTACTCGAGTACTTCTCTTGTTGTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_012460.2-517s1c1
Sequence:CCGGGACTGTGTTAAAGACTTCACACTCGAGTGTGAAGTCTTTAACACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151300    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_012460.2-944s1c1
Sequence:CCGGGCTTGGTCACTTGATTAGAAACTCGAGTTTCTAATCAAGTGACCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012460.2-519s1c1
Sequence:CCGGCTGTGTTAAAGACTTCACAACCTCGAGGTTGTGAAGTCTTTAACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152075    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012460.2-914s1c1
Sequence:CCGGCAACATTTGTTGAGGCCTTATCTCGAGATAAGGCCTCAACAAATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_012460.2-567s1c1
Sequence:CCGGCTGTTCAGAACATTGCTTACACTCGAGTGTAAGCAATGTTCTGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012460.2-698s1c1
Sequence:CCGGGAAGTCCTGATGGATGAACTTCTCGAGAAGTTCATCCATCAGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012460.2-826s1c1
Sequence:CCGGCAAATGGAAACCGCTGGAGAACTCGAGTTCTCCAGCGGTTTCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012460.2-559s1c1
Sequence:CCGGGAGACCACCTGTTCAGAACATCTCGAGATGTTCTGAACAGGTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012460
VALIDATED
TIMM9 MISSION shRNA shRNA Plasmid DNA
translocase of inner mitochondrial membrane 9 homolog (yeast)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153536    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_012460.2-795s1c1
Sequence:CCGGCCATGTTCAACCATCTGTCATCTCGAGATGACAGATGGTTGAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012460.2-628s1c1
Sequence:CCGGCAGGAATATCATATTCAGCAGCTCGAGCTGCTGAATATGATATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012460.2-489s1c1
Sequence:CCGGCAATAAACTTACAGAGACCTGCTCGAGCAGGTCTCTGTAAGTTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012460.2-529s1c1
Sequence:CCGGGACTTCACAACAAGAGAAGTACTCGAGTACTTCTCTTGTTGTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_012460.2-517s1c1
Sequence:CCGGGACTGTGTTAAAGACTTCACACTCGAGTGTGAAGTCTTTAACACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151300    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_012460.2-944s1c1
Sequence:CCGGGCTTGGTCACTTGATTAGAAACTCGAGTTTCTAATCAAGTGACCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012460.2-519s1c1
Sequence:CCGGCTGTGTTAAAGACTTCACAACCTCGAGGTTGTGAAGTCTTTAACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152075    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012460.2-914s1c1
Sequence:CCGGCAACATTTGTTGAGGCCTTATCTCGAGATAAGGCCTCAACAAATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_012460.2-567s1c1
Sequence:CCGGCTGTTCAGAACATTGCTTACACTCGAGTGTAAGCAATGTTCTGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012460.2-698s1c1
Sequence:CCGGGAAGTCCTGATGGATGAACTTCTCGAGAAGTTCATCCATCAGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012460.2-826s1c1
Sequence:CCGGCAAATGGAAACCGCTGGAGAACTCGAGTTCTCCAGCGGTTTCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012460.2-559s1c1
Sequence:CCGGGAGACCACCTGTTCAGAACATCTCGAGATGTTCTGAACAGGTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012460
VALIDATED
TIMM9 MISSION shRNA Lentiviral Transduction Particles
translocase of inner mitochondrial membrane 9 homolog (yeast)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153536    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_012460.2-795s1c1
Sequence:CCGGCCATGTTCAACCATCTGTCATCTCGAGATGACAGATGGTTGAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012460.2-628s1c1
Sequence:CCGGCAGGAATATCATATTCAGCAGCTCGAGCTGCTGAATATGATATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012460.2-489s1c1
Sequence:CCGGCAATAAACTTACAGAGACCTGCTCGAGCAGGTCTCTGTAAGTTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012460.2-529s1c1
Sequence:CCGGGACTTCACAACAAGAGAAGTACTCGAGTACTTCTCTTGTTGTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_012460.2-517s1c1
Sequence:CCGGGACTGTGTTAAAGACTTCACACTCGAGTGTGAAGTCTTTAACACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151300    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_012460.2-944s1c1
Sequence:CCGGGCTTGGTCACTTGATTAGAAACTCGAGTTTCTAATCAAGTGACCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012460.2-519s1c1
Sequence:CCGGCTGTGTTAAAGACTTCACAACCTCGAGGTTGTGAAGTCTTTAACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152075    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012460.2-914s1c1
Sequence:CCGGCAACATTTGTTGAGGCCTTATCTCGAGATAAGGCCTCAACAAATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_012460.2-567s1c1
Sequence:CCGGCTGTTCAGAACATTGCTTACACTCGAGTGTAAGCAATGTTCTGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012460.2-698s1c1
Sequence:CCGGGAAGTCCTGATGGATGAACTTCTCGAGAAGTTCATCCATCAGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012460.2-826s1c1
Sequence:CCGGCAAATGGAAACCGCTGGAGAACTCGAGTTCTCCAGCGGTTTCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012460.2-559s1c1
Sequence:CCGGGAGACCACCTGTTCAGAACATCTCGAGATGTTCTGAACAGGTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024853
VALIDATED
TIMM9 MISSION shRNA Bacterial Glycerol Stock
translocase of inner mitochondrial membrane 9 homolog (yeast)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114206    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024853.1-732s1c1
Sequence:CCGGCCAATGGAAACCACCAGAGAACTCGAGTTCTCTGGTGGTTTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024853.1-536s1c1
Sequence:CCGGGAATATCACATTCAGCAGAATCTCGAGATTCTGCTGAATGTGATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024853.1-383s1c1
Sequence:CCGGCTGGGAACCTACAATAAACTTCTCGAGAAGTTTATTGTAGGTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024853.1-521s1c1
Sequence:CCGGTCCGTGAGATTTCAGGAATATCTCGAGATATTCCTGAAATCTCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024853.1-436s1c1
Sequence:CCGGCTTCACAACAAGAGAGGTGAACTCGAGTTCACCTCTCTTGTTGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024853.1-383s21c1
Sequence:CCGGCTGGGAACCTACAATAAACTTCTCGAGAAGTTTATTGTAGGTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024853.1-536s21c1
Sequence:CCGGGAATATCACATTCAGCAGAATCTCGAGATTCTGCTGAATGTGATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024853.1-436s21c1
Sequence:CCGGCTTCACAACAAGAGAGGTGAACTCGAGTTCACCTCTCTTGTTGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024853.1-732s21c1
Sequence:CCGGCCAATGGAAACCACCAGAGAACTCGAGTTCTCTGGTGGTTTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024853
VALIDATED
TIMM9 MISSION shRNA shRNA Plasmid DNA
translocase of inner mitochondrial membrane 9 homolog (yeast)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114206    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024853.1-732s1c1
Sequence:CCGGCCAATGGAAACCACCAGAGAACTCGAGTTCTCTGGTGGTTTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024853.1-536s1c1
Sequence:CCGGGAATATCACATTCAGCAGAATCTCGAGATTCTGCTGAATGTGATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024853.1-383s1c1
Sequence:CCGGCTGGGAACCTACAATAAACTTCTCGAGAAGTTTATTGTAGGTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024853.1-521s1c1
Sequence:CCGGTCCGTGAGATTTCAGGAATATCTCGAGATATTCCTGAAATCTCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024853.1-436s1c1
Sequence:CCGGCTTCACAACAAGAGAGGTGAACTCGAGTTCACCTCTCTTGTTGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024853.1-383s21c1
Sequence:CCGGCTGGGAACCTACAATAAACTTCTCGAGAAGTTTATTGTAGGTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024853.1-536s21c1
Sequence:CCGGGAATATCACATTCAGCAGAATCTCGAGATTCTGCTGAATGTGATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024853.1-436s21c1
Sequence:CCGGCTTCACAACAAGAGAGGTGAACTCGAGTTCACCTCTCTTGTTGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024853.1-732s21c1
Sequence:CCGGCCAATGGAAACCACCAGAGAACTCGAGTTCTCTGGTGGTTTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024853
VALIDATED
TIMM9 MISSION shRNA Lentiviral Transduction Particles
translocase of inner mitochondrial membrane 9 homolog (yeast)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114206    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024853.1-732s1c1
Sequence:CCGGCCAATGGAAACCACCAGAGAACTCGAGTTCTCTGGTGGTTTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024853.1-536s1c1
Sequence:CCGGGAATATCACATTCAGCAGAATCTCGAGATTCTGCTGAATGTGATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024853.1-383s1c1
Sequence:CCGGCTGGGAACCTACAATAAACTTCTCGAGAAGTTTATTGTAGGTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024853.1-521s1c1
Sequence:CCGGTCCGTGAGATTTCAGGAATATCTCGAGATATTCCTGAAATCTCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024853.1-436s1c1
Sequence:CCGGCTTCACAACAAGAGAGGTGAACTCGAGTTCACCTCTCTTGTTGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024853.1-383s21c1
Sequence:CCGGCTGGGAACCTACAATAAACTTCTCGAGAAGTTTATTGTAGGTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024853.1-536s21c1
Sequence:CCGGGAATATCACATTCAGCAGAATCTCGAGATTCTGCTGAATGTGATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024853.1-436s21c1
Sequence:CCGGCTTCACAACAAGAGAGGTGAACTCGAGTTCACCTCTCTTGTTGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024853.1-732s21c1
Sequence:CCGGCCAATGGAAACCACCAGAGAACTCGAGTTCTCTGGTGGTTTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks