EMAIL THIS PAGE TO A FRIEND

TIMMDC1

translocase of inner mitochondrial membrane domain containing 1

Synonyms: C3orf1
Gene ID:
Mouse(76916) translocase of inner mitochondrial membrane domain containing 1
Rat(303922) translocase of inner mitochondrial membrane domain containing 1
Zebrafish(550526) translocase of inner mitochondrial membrane domain containing 1
chicken(418453) translocase of inner mitochondrial membrane domain containing 1
domestic cat(101101075) translocase of inner mitochondrial membrane domain containing 1
dog(487994) translocase of inner mitochondrial membrane domain containing 1
cow(507206) translocase of inner mitochondrial membrane domain containing 1
sheep(101105967) translocase of inner mitochondrial membrane domain containing 1
domestic guinea pig(100713006) translocase of inner mitochondrial membrane domain containing 1
naked mole-rat(101706057) translocase of inner mitochondrial membrane domain containing 1
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024273 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024273 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024273 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016589 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016589 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016589 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016589 Rosetta Predictions human pricing
NM_001007676 Rosetta Predictions rat pricing
NM_024273 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016589 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024124 predicted 1064
2 SASI_Hs01_00024126 predicted 837
3 SASI_Hs01_00024127 predicted 1027
4 SASI_Hs01_00024129 predicted 1116
5 SASI_Hs01_00024130 predicted 663
6 SASI_Hs01_00024131 predicted 1011
7 SASI_Hs02_00349721 predicted 676
8 SASI_Hs01_00024133 predicted 422
9 SASI_Hs02_00349722 predicted 461
10 SASI_Hs02_00349723 predicted 356
11 SASI_Hs01_00024125 predicted 639
12 SASI_Hs01_00024128 predicted 975
13 SASI_Hs01_00024132 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007676 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053534 predicted 415
2 SASI_Rn01_00053536 predicted 871
3 SASI_Rn01_00053537 predicted 431
4 SASI_Rn01_00053538 predicted 1092
5 SASI_Rn01_00053539 predicted 727
6 SASI_Rn01_00053540 predicted 545
7 SASI_Rn01_00053541 predicted 827
8 SASI_Rn01_00053542 predicted 278
9 SASI_Rn01_00053543 predicted 1098
10 SASI_Rn02_00198806 predicted 596
11 SASI_Rn01_00053535 predicted 1046
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024273 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327684 predicted 324
2 SASI_Mm02_00327685 predicted 338
3 SASI_Mm02_00327686 predicted 404
4 SASI_Mm02_00327687 predicted 433
5 SASI_Mm02_00327688 predicted 419
6 SASI_Mm02_00327689 predicted 414
7 SASI_Mm02_00327690 predicted 545
8 SASI_Mm02_00327691 predicted 594
9 SASI_Mm02_00327692 predicted 659
10 SASI_Mm02_00327693 predicted 550
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024273
VALIDATED
TIMMDC1 MISSION shRNA Bacterial Glycerol Stock
translocase of inner mitochondrial membrane domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024273.1-854s21c1
Sequence:CCGGGAGAAGATTCAACCTGAGGAACTCGAGTTCCTCAGGTTGAATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024273.1-1044s21c1
Sequence:CCGGCGGTCACTTGTCTCTGATCTTCTCGAGAAGATCAGAGACAAGTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024273.1-398s21c1
Sequence:CCGGCGCTACATTGAACAGAGCCAACTCGAGTTGGCTCTGTTCAATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024273.1-410s21c1
Sequence:CCGGCAGAGCCAAGCGGAGATTTATCTCGAGATAAATCTCCGCTTGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024273.1-410s1c1
Sequence:CCGGCAGAGCCAAGCGGAGATTTATCTCGAGATAAATCTCCGCTTGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024273.1-398s1c1
Sequence:CCGGCGCTACATTGAACAGAGCCAACTCGAGTTGGCTCTGTTCAATGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024273.1-1351s1c1
Sequence:CCGGGCCTGAGCTATTTAATGAGAACTCGAGTTCTCATTAAATAGCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024273.1-854s1c1
Sequence:CCGGGAGAAGATTCAACCTGAGGAACTCGAGTTCCTCAGGTTGAATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202057    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024273.1-1044s1c1
Sequence:CCGGCGGTCACTTGTCTCTGATCTTCTCGAGAAGATCAGAGACAAGTGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024273
VALIDATED
TIMMDC1 MISSION shRNA shRNA Plasmid DNA
translocase of inner mitochondrial membrane domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024273.1-854s21c1
Sequence:CCGGGAGAAGATTCAACCTGAGGAACTCGAGTTCCTCAGGTTGAATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024273.1-1044s21c1
Sequence:CCGGCGGTCACTTGTCTCTGATCTTCTCGAGAAGATCAGAGACAAGTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024273.1-398s21c1
Sequence:CCGGCGCTACATTGAACAGAGCCAACTCGAGTTGGCTCTGTTCAATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024273.1-410s21c1
Sequence:CCGGCAGAGCCAAGCGGAGATTTATCTCGAGATAAATCTCCGCTTGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024273.1-410s1c1
Sequence:CCGGCAGAGCCAAGCGGAGATTTATCTCGAGATAAATCTCCGCTTGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024273.1-398s1c1
Sequence:CCGGCGCTACATTGAACAGAGCCAACTCGAGTTGGCTCTGTTCAATGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024273.1-1351s1c1
Sequence:CCGGGCCTGAGCTATTTAATGAGAACTCGAGTTCTCATTAAATAGCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024273.1-854s1c1
Sequence:CCGGGAGAAGATTCAACCTGAGGAACTCGAGTTCCTCAGGTTGAATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202057    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024273.1-1044s1c1
Sequence:CCGGCGGTCACTTGTCTCTGATCTTCTCGAGAAGATCAGAGACAAGTGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024273
VALIDATED
TIMMDC1 MISSION shRNA Lentiviral Transduction Particles
translocase of inner mitochondrial membrane domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024273.1-854s21c1
Sequence:CCGGGAGAAGATTCAACCTGAGGAACTCGAGTTCCTCAGGTTGAATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024273.1-1044s21c1
Sequence:CCGGCGGTCACTTGTCTCTGATCTTCTCGAGAAGATCAGAGACAAGTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024273.1-398s21c1
Sequence:CCGGCGCTACATTGAACAGAGCCAACTCGAGTTGGCTCTGTTCAATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024273.1-410s21c1
Sequence:CCGGCAGAGCCAAGCGGAGATTTATCTCGAGATAAATCTCCGCTTGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024273.1-410s1c1
Sequence:CCGGCAGAGCCAAGCGGAGATTTATCTCGAGATAAATCTCCGCTTGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024273.1-398s1c1
Sequence:CCGGCGCTACATTGAACAGAGCCAACTCGAGTTGGCTCTGTTCAATGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024273.1-1351s1c1
Sequence:CCGGGCCTGAGCTATTTAATGAGAACTCGAGTTCTCATTAAATAGCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024273.1-854s1c1
Sequence:CCGGGAGAAGATTCAACCTGAGGAACTCGAGTTCCTCAGGTTGAATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202057    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024273.1-1044s1c1
Sequence:CCGGCGGTCACTTGTCTCTGATCTTCTCGAGAAGATCAGAGACAAGTGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016589
VALIDATED
TIMMDC1 MISSION shRNA Bacterial Glycerol Stock
translocase of inner mitochondrial membrane domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016589.3-916s21c1
Sequence:CCGGGAGTGGAAAGGCAGACTACAACTCGAGTTGTAGTCTGCCTTTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016589.3-638s21c1
Sequence:CCGGCTGCAGTGTTTGTGACTATATCTCGAGATATAGTCACAAACACTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016589.3-414s21c1
Sequence:CCGGGCAGAGAATTTCAAAGGACCTCTCGAGAGGTCCTTTGAAATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016589.3-531s21c1
Sequence:CCGGGCAGAGCCAGGCAGAAATTTACTCGAGTAAATTTCTGCCTGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016589.1-504s1c1
Sequence:CCGGGCAGAGCCAGGCAGAAATTTACTCGAGTAAATTTCTGCCTGGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016589.1-889s1c1
Sequence:CCGGGAGTGGAAAGGCAGACTACAACTCGAGTTGTAGTCTGCCTTTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016589.1-215s1c1
Sequence:CCGGGCTTTCTCTGTAGAGCATTGTCTCGAGACAATGCTCTACAGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016589.1-611s1c1
Sequence:CCGGCTGCAGTGTTTGTGACTATATCTCGAGATATAGTCACAAACACTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016589.1-392s1c1
Sequence:CCGGGAATTTCAAAGGACCTTGCTACTCGAGTAGCAAGGTCCTTTGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016589.1-387s1c1
Sequence:CCGGGCAGAGAATTTCAAAGGACCTCTCGAGAGGTCCTTTGAAATTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016589
VALIDATED
TIMMDC1 MISSION shRNA shRNA Plasmid DNA
translocase of inner mitochondrial membrane domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016589.3-916s21c1
Sequence:CCGGGAGTGGAAAGGCAGACTACAACTCGAGTTGTAGTCTGCCTTTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016589.3-638s21c1
Sequence:CCGGCTGCAGTGTTTGTGACTATATCTCGAGATATAGTCACAAACACTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016589.3-414s21c1
Sequence:CCGGGCAGAGAATTTCAAAGGACCTCTCGAGAGGTCCTTTGAAATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016589.3-531s21c1
Sequence:CCGGGCAGAGCCAGGCAGAAATTTACTCGAGTAAATTTCTGCCTGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016589.1-504s1c1
Sequence:CCGGGCAGAGCCAGGCAGAAATTTACTCGAGTAAATTTCTGCCTGGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016589.1-889s1c1
Sequence:CCGGGAGTGGAAAGGCAGACTACAACTCGAGTTGTAGTCTGCCTTTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016589.1-215s1c1
Sequence:CCGGGCTTTCTCTGTAGAGCATTGTCTCGAGACAATGCTCTACAGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016589.1-611s1c1
Sequence:CCGGCTGCAGTGTTTGTGACTATATCTCGAGATATAGTCACAAACACTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016589.1-392s1c1
Sequence:CCGGGAATTTCAAAGGACCTTGCTACTCGAGTAGCAAGGTCCTTTGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016589.1-387s1c1
Sequence:CCGGGCAGAGAATTTCAAAGGACCTCTCGAGAGGTCCTTTGAAATTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016589
VALIDATED
TIMMDC1 MISSION shRNA Lentiviral Transduction Particles
translocase of inner mitochondrial membrane domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016589.3-916s21c1
Sequence:CCGGGAGTGGAAAGGCAGACTACAACTCGAGTTGTAGTCTGCCTTTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016589.3-638s21c1
Sequence:CCGGCTGCAGTGTTTGTGACTATATCTCGAGATATAGTCACAAACACTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016589.3-414s21c1
Sequence:CCGGGCAGAGAATTTCAAAGGACCTCTCGAGAGGTCCTTTGAAATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016589.3-531s21c1
Sequence:CCGGGCAGAGCCAGGCAGAAATTTACTCGAGTAAATTTCTGCCTGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016589.1-504s1c1
Sequence:CCGGGCAGAGCCAGGCAGAAATTTACTCGAGTAAATTTCTGCCTGGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016589.1-889s1c1
Sequence:CCGGGAGTGGAAAGGCAGACTACAACTCGAGTTGTAGTCTGCCTTTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016589.1-215s1c1
Sequence:CCGGGCTTTCTCTGTAGAGCATTGTCTCGAGACAATGCTCTACAGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016589.1-611s1c1
Sequence:CCGGCTGCAGTGTTTGTGACTATATCTCGAGATATAGTCACAAACACTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016589.1-392s1c1
Sequence:CCGGGAATTTCAAAGGACCTTGCTACTCGAGTAGCAAGGTCCTTTGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016589.1-387s1c1
Sequence:CCGGGCAGAGAATTTCAAAGGACCTCTCGAGAGGTCCTTTGAAATTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks