EMAIL THIS PAGE TO A FRIEND

TIMP1

TIMP metallopeptidase inhibitor 1

Synonyms: CLGI EPA EPO HCI TIMP
UniProtKB ID: P01033, Q14252, Q9UCU1
Gene ID:
Human(7076) Summary: This gene belongs to the TIMP gene family. The proteins encoded by this gene family are natural inhibitors of the matrix metalloproteinases (MMPs), a group of peptidases involved in degradation of the extracellular matrix. In addition to its inhibitory role against most of the known MMPs, the encoded protein is able to promote cell proliferation in a wide range of cell types, and may also have an anti-apoptotic function. Transcription of this gene is highly inducible in response to many cytokines and hormones. In addition, the expression from some but not all inactive X chromosomes suggests that this gene inactivation is polymorphic in human females. This gene is located within intron 6 of the synapsin I gene and is transcribed in the opposite direction. [provided by RefSeq, Jul 2008]
Mouse(21857) tissue inhibitor of metalloproteinase 1
Rat(116510) TIMP metallopeptidase inhibitor 1
cow(282092) TIMP metallopeptidase inhibitor 1
sheep(443331) TIMP metallopeptidase inhibitor 1
naked mole-rat(101722238) TIMP metallopeptidase inhibitor 1
domestic guinea pig(101787552) TIMP metallopeptidase inhibitor 1
Horse(100034220) TIMP metallopeptidase inhibitor 1
dog(403816) TIMP metallopeptidase inhibitor 1
domestic cat(101095886) TIMP metallopeptidase inhibitor 1
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003254 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003254 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003254 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011593 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011593 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011593 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003254 Rosetta Predictions human pricing
NM_053819 Rosetta Predictions rat pricing
NM_001044384 Rosetta Predictions mouse pricing
NM_011593 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003254 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019072 predicted 282
2 SASI_Hs01_00019074 predicted 355
3 SASI_Hs01_00019076 predicted 447
4 SASI_Hs01_00019078 predicted 367
5 SASI_Hs02_00335297 predicted 280
6 SASI_Hs02_00335298 predicted 352
7 SASI_Hs02_00335299 predicted 543
8 SASI_Hs02_00335300 predicted 426
9 SASI_Hs01_00019079 predicted 298
10 SASI_Hs01_00019080 predicted 457
11 SASI_Hs01_00019073 predicted 426
12 SASI_Hs01_00019075 predicted 490
13 SASI_Hs01_00019077 predicted 610
14 SASI_Hs01_00019081 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053819 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052174 predicted 357
2 SASI_Rn01_00052175 predicted 510
3 SASI_Rn01_00052176 predicted 223
4 SASI_Rn01_00052177 predicted 493
5 SASI_Rn01_00052178 predicted 326
6 SASI_Rn01_00052179 predicted 211
7 SASI_Rn01_00052181 predicted 199
8 SASI_Rn01_00052182 predicted 481
9 SASI_Rn01_00052183 predicted 310
10 SASI_Rn02_00266650 predicted 400
11 SASI_Rn01_00052180 predicted 303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044384 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291264 predicted 403
2 SASI_Mm02_00291265 predicted 375
3 SASI_Mm02_00291266 predicted 665
4 SASI_Mm02_00291267 predicted 649
5 SASI_Mm02_00291268 predicted 392
6 SASI_Mm02_00291269 predicted 372
7 SASI_Mm02_00291270 predicted 494
8 SASI_Mm02_00291271 predicted 570
9 SASI_Mm02_00291272 predicted 578
10 SASI_Mm02_00291273 predicted 632
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011593 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183166 predicted 394
2 SASI_Mm01_00183167 predicted 375
3 SASI_Mm02_00320998 predicted 663
4 SASI_Mm02_00320999 predicted 654
5 SASI_Mm01_00183170 predicted 383
6 SASI_Mm01_00183171 predicted 377
7 SASI_Mm02_00321000 predicted 492
8 SASI_Mm02_00321001 predicted 565
9 SASI_Mm02_00321002 predicted 569
10 SASI_Mm02_00321003 predicted 624
11 SASI_Mm01_00183165 predicted 329
12 SASI_Mm01_00183168 predicted 336
13 SASI_Mm01_00183169 predicted 337
14 SASI_Mm01_00183172 predicted 399
15 SASI_Mm01_00183173 predicted 344
16 SASI_Mm01_00183174 predicted 363
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003254
VALIDATED
TIMP1 MISSION shRNA Bacterial Glycerol Stock
TIMP metallopeptidase inhibitor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003254.1-511s1c1
Sequence:CCGGGCACAGTGTTTCCCTGTTTATCTCGAGATAAACAGGGAAACACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003254.1-236s1c1
Sequence:CCGGCCAGCGTTATGAGATCAAGATCTCGAGATCTTGATCTCATAACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003254.1-213s1c1
Sequence:CCGGGAAGTCAACCAGACCACCTTACTCGAGTAAGGTGGTCTGGTTGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003254.1-96s1c1
Sequence:CCGGCTGTTGTTGCTGTGGCTGATACTCGAGTATCAGCCACAGCAACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003254.2-641s21c1
Sequence:CCGGGCACAGTGTTTCCCTGTTTATCTCGAGATAAACAGGGAAACACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003254.2-343s21c1
Sequence:CCGGGAAGTCAACCAGACCACCTTACTCGAGTAAGGTGGTCTGGTTGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003254.2-675s21c1
Sequence:CCGGACTGCAGAGTGGCACTCATTGCTCGAGCAATGAGTGCCACTCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_003254.2-285s21c1
Sequence:CCGGACAGACGGCCTTCTGCAATTCCTCGAGGAATTGCAGAAGGCCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003254
VALIDATED
TIMP1 MISSION shRNA shRNA Plasmid DNA
TIMP metallopeptidase inhibitor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003254.1-511s1c1
Sequence:CCGGGCACAGTGTTTCCCTGTTTATCTCGAGATAAACAGGGAAACACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003254.1-236s1c1
Sequence:CCGGCCAGCGTTATGAGATCAAGATCTCGAGATCTTGATCTCATAACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003254.1-213s1c1
Sequence:CCGGGAAGTCAACCAGACCACCTTACTCGAGTAAGGTGGTCTGGTTGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003254.1-96s1c1
Sequence:CCGGCTGTTGTTGCTGTGGCTGATACTCGAGTATCAGCCACAGCAACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003254.2-641s21c1
Sequence:CCGGGCACAGTGTTTCCCTGTTTATCTCGAGATAAACAGGGAAACACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003254.2-343s21c1
Sequence:CCGGGAAGTCAACCAGACCACCTTACTCGAGTAAGGTGGTCTGGTTGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003254.2-675s21c1
Sequence:CCGGACTGCAGAGTGGCACTCATTGCTCGAGCAATGAGTGCCACTCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_003254.2-285s21c1
Sequence:CCGGACAGACGGCCTTCTGCAATTCCTCGAGGAATTGCAGAAGGCCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003254
VALIDATED
TIMP1 MISSION shRNA Lentiviral Transduction Particles
TIMP metallopeptidase inhibitor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003254.1-511s1c1
Sequence:CCGGGCACAGTGTTTCCCTGTTTATCTCGAGATAAACAGGGAAACACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003254.1-236s1c1
Sequence:CCGGCCAGCGTTATGAGATCAAGATCTCGAGATCTTGATCTCATAACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003254.1-213s1c1
Sequence:CCGGGAAGTCAACCAGACCACCTTACTCGAGTAAGGTGGTCTGGTTGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003254.1-96s1c1
Sequence:CCGGCTGTTGTTGCTGTGGCTGATACTCGAGTATCAGCCACAGCAACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003254.2-641s21c1
Sequence:CCGGGCACAGTGTTTCCCTGTTTATCTCGAGATAAACAGGGAAACACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003254.2-343s21c1
Sequence:CCGGGAAGTCAACCAGACCACCTTACTCGAGTAAGGTGGTCTGGTTGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003254.2-675s21c1
Sequence:CCGGACTGCAGAGTGGCACTCATTGCTCGAGCAATGAGTGCCACTCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_003254.2-285s21c1
Sequence:CCGGACAGACGGCCTTCTGCAATTCCTCGAGGAATTGCAGAAGGCCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011593
VALIDATED
TIMP1 MISSION shRNA Bacterial Glycerol Stock
TIMP metallopeptidase inhibitor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011593.1-120s1c1
Sequence:CCGGCCTGGTCATAAGGGCTAAATTCTCGAGAATTTAGCCCTTATGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011593.1-36s1c1
Sequence:CCGGCCTCTTGTTGCTATCACTGATCTCGAGATCAGTGATAGCAACAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011593.1-470s1c1
Sequence:CCGGCCTGTTTATCTATCCCTTGCACTCGAGTGCAAGGGATAGATAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011593.1-337s1c1
Sequence:CCGGCGCCTAAGGAACGGGAAATTTCTCGAGAAATTTCCCGTTCCTTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011593.1-167s1c1
Sequence:CCGGCCACCTTATACCAGCGTTATACTCGAGTATAACGCTGGTATAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011593.2-466s21c1
Sequence:CCGGAGAACCGCAGTGAAGAGTTTCCTCGAGGAAACTCTTCACTGCGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011593.2-537s21c1
Sequence:CCGGTTCTTGGTTCCCTGGCGTACTCTCGAGAGTACGCCAGGGAACCAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011593.2-578s21c1
Sequence:CCGGAGCTTTCTCAAAGACCTATAGCTCGAGCTATAGGTCTTTGAGAAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011593.2-666s21c1
Sequence:CCGGCACTGTTTGTGGACGGATCAGCTCGAGCTGATCCGTCCACAAACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011593.2-706s21c1
Sequence:CCGGACTACCAGAGCCGTCACTTTGCTCGAGCAAAGTGACGGCTCTGGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011593
VALIDATED
TIMP1 MISSION shRNA shRNA Plasmid DNA
TIMP metallopeptidase inhibitor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011593.1-120s1c1
Sequence:CCGGCCTGGTCATAAGGGCTAAATTCTCGAGAATTTAGCCCTTATGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011593.1-36s1c1
Sequence:CCGGCCTCTTGTTGCTATCACTGATCTCGAGATCAGTGATAGCAACAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011593.1-470s1c1
Sequence:CCGGCCTGTTTATCTATCCCTTGCACTCGAGTGCAAGGGATAGATAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011593.1-337s1c1
Sequence:CCGGCGCCTAAGGAACGGGAAATTTCTCGAGAAATTTCCCGTTCCTTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011593.1-167s1c1
Sequence:CCGGCCACCTTATACCAGCGTTATACTCGAGTATAACGCTGGTATAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011593.2-466s21c1
Sequence:CCGGAGAACCGCAGTGAAGAGTTTCCTCGAGGAAACTCTTCACTGCGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011593.2-537s21c1
Sequence:CCGGTTCTTGGTTCCCTGGCGTACTCTCGAGAGTACGCCAGGGAACCAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011593.2-578s21c1
Sequence:CCGGAGCTTTCTCAAAGACCTATAGCTCGAGCTATAGGTCTTTGAGAAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011593.2-666s21c1
Sequence:CCGGCACTGTTTGTGGACGGATCAGCTCGAGCTGATCCGTCCACAAACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011593.2-706s21c1
Sequence:CCGGACTACCAGAGCCGTCACTTTGCTCGAGCAAAGTGACGGCTCTGGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011593
VALIDATED
TIMP1 MISSION shRNA Lentiviral Transduction Particles
TIMP metallopeptidase inhibitor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011593.1-120s1c1
Sequence:CCGGCCTGGTCATAAGGGCTAAATTCTCGAGAATTTAGCCCTTATGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011593.1-36s1c1
Sequence:CCGGCCTCTTGTTGCTATCACTGATCTCGAGATCAGTGATAGCAACAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011593.1-470s1c1
Sequence:CCGGCCTGTTTATCTATCCCTTGCACTCGAGTGCAAGGGATAGATAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011593.1-337s1c1
Sequence:CCGGCGCCTAAGGAACGGGAAATTTCTCGAGAAATTTCCCGTTCCTTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011593.1-167s1c1
Sequence:CCGGCCACCTTATACCAGCGTTATACTCGAGTATAACGCTGGTATAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011593.2-466s21c1
Sequence:CCGGAGAACCGCAGTGAAGAGTTTCCTCGAGGAAACTCTTCACTGCGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011593.2-537s21c1
Sequence:CCGGTTCTTGGTTCCCTGGCGTACTCTCGAGAGTACGCCAGGGAACCAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011593.2-578s21c1
Sequence:CCGGAGCTTTCTCAAAGACCTATAGCTCGAGCTATAGGTCTTTGAGAAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011593.2-666s21c1
Sequence:CCGGCACTGTTTGTGGACGGATCAGCTCGAGCTGATCCGTCCACAAACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011593.2-706s21c1
Sequence:CCGGACTACCAGAGCCGTCACTTTGCTCGAGCAAAGTGACGGCTCTGGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks