EMAIL THIS PAGE TO A FRIEND

TIMP2

TIMP metallopeptidase inhibitor 2

Synonyms: CSC-21K DDC8
UniProtKB ID: P16035, Q16121, Q93006, Q9UDF7
Gene ID:
Human(7077) Summary: This gene is a member of the TIMP gene family. The proteins encoded by this gene family are natural inhibitors of the matrix metalloproteinases, a group of peptidases involved in degradation of the extracellular matrix. In addition to an inhibitory role against metalloproteinases, the encoded protein has a unique role among TIMP family members in its ability to directly suppress the proliferation of endothelial cells. As a result, the encoded protein may be critical to the maintenance of tissue homeostasis by suppressing the proliferation of quiescent tissues in response to angiogenic factors, and by inhibiting protease activity in tissues undergoing remodelling of the extracellular matrix. [provided by RefSeq, Jul 2008]
Mouse(21858) tissue inhibitor of metalloproteinase 2
Rat(29543) TIMP metallopeptidase inhibitor 2
chicken(374178) TIMP metallopeptidase inhibitor 2
dog(403633) TIMP metallopeptidase inhibitor 2
Horse(100034134) TIMP metallopeptidase inhibitor 2
domestic cat(101083125) TIMP metallopeptidase inhibitor 2
domestic guinea pig(100135629) tissue inhibitor of metalloproteinase 2
naked mole-rat(101707659) TIMP metallopeptidase inhibitor 2
Domestic Rabbit(100008689) TIMP metallopeptidase inhibitor 2
cow(282093) TIMP metallopeptidase inhibitor 2
sheep(100217406) TIMP metallopeptidase inhibitor 2
146 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502972 Anti-TIMP2 antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, western blot pricing
SAB2106577 Anti-TIMP2 antibody produced in rabbit affinity isolated antibody rabbit, human, horse, mouse, sheep, guinea pig
ELISA, western blot pricing
T7937 Anti-Tissue Inhibitor of Metalloproteinase-2, C-Terminal antibody produced in rabbit ~1 mg/mL, buffered aqueous solution, affinity isolated antibody rabbit, rat, mouse, human, guinea pig, bovine
immunohistochemistry, western blot pricing
T8062 Anti-Tissue Inhibitor of Metalloproteinase-2, First Loop antibody produced in rabbit ~1 mg/mL, buffered aqueous glycerol solution, affinity isolated antibody human
western blot pricing
T8072 Anti-Tissue Inhibitor of Metalloproteinase-2, Second Loop antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution human
western blot pricing
WH0007077M1 Monoclonal Anti-TIMP2 antibody produced in mouse clone 5D7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1400279 Monoclonal Anti-TIMP2 antibody produced in mouse clone 1C3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1400280 Monoclonal Anti-TIMP2 antibody produced in mouse clone 5B11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4100354 Monoclonal Anti-TIMP2 antibody produced in mouse clone TIMP2-B302, culture supernatant human
western blot pricing
SAB1404471 Monoclonal Anti-TIMP2, (C-terminal) antibody produced in mouse clone 4F5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003255 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003255 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003255 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011594 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011594 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011594 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003255 Rosetta Predictions human pricing
NM_021989 Rosetta Predictions rat pricing
NM_011594 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003255 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074203 predicted 1288
2 SASI_Hs01_00074204 predicted 1011
3 SASI_Hs01_00074205 predicted 505
4 SASI_Hs01_00074206 predicted 813
5 SASI_Hs01_00074207 predicted 508
6 SASI_Hs01_00074208 predicted 616
7 SASI_Hs01_00074209 predicted 552
8 SASI_Hs01_00074210 predicted 510
9 SASI_Hs01_00074211 predicted 950
10 SASI_Hs01_00074212 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021989 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099219 predicted 289
2 SASI_Rn01_00099220 predicted 595
3 SASI_Rn01_00099221 predicted 566
4 SASI_Rn01_00099222 predicted 491
5 SASI_Rn01_00099223 predicted 474
6 SASI_Rn01_00099224 predicted 445
7 SASI_Rn01_00099225 predicted 243
8 SASI_Rn01_00099226 predicted 621
9 SASI_Rn01_00099227 predicted 475
10 SASI_Rn01_00099228 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011594 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154973 predicted 794
2 SASI_Mm01_00154974 predicted 486
3 SASI_Mm01_00154975 predicted 685
4 SASI_Mm01_00154976 predicted 1322
5 SASI_Mm01_00154978 predicted 1369
6 SASI_Mm01_00154979 predicted 747
7 SASI_Mm01_00154980 predicted 754
8 SASI_Mm01_00154981 predicted 818
9 SASI_Mm02_00321004 predicted 1296
10 SASI_Mm01_00154982 predicted 1254
11 SASI_Mm01_00154977 predicted 441
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003255
VALIDATED
TIMP2 MISSION shRNA Bacterial Glycerol Stock
TIMP metallopeptidase inhibitor 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003255.4-426s21c1
Sequence:CCGGGATGTAGTGATCAGGGCCAAACTCGAGTTTGGCCCTGATCACTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003255.4-866s21c1
Sequence:CCGGCAAGTTCTTCGCCTGCATCAACTCGAGTTGATGCAGGCGAAGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003255.4-479s21c1
Sequence:CCGGCGACATTTATGGCAACCCTATCTCGAGATAGGGTTGCCATAAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003255.4-509s21c1
Sequence:CCGGCCAGTATGAGATCAAGCAGATCTCGAGATCTGCTTGATCTCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003255.4-546s21c1
Sequence:CCGGCCTGAGAAGGATATAGAGTTTCTCGAGAAACTCTATATCCTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003255.2-479s1c1
Sequence:CCGGCGACATTTATGGCAACCCTATCTCGAGATAGGGTTGCCATAAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003255.2-866s1c1
Sequence:CCGGCAAGTTCTTCGCCTGCATCAACTCGAGTTGATGCAGGCGAAGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003255.2-546s1c1
Sequence:CCGGCCTGAGAAGGATATAGAGTTTCTCGAGAAACTCTATATCCTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003255.2-426s1c1
Sequence:CCGGGATGTAGTGATCAGGGCCAAACTCGAGTTTGGCCCTGATCACTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003255.2-509s1c1
Sequence:CCGGCCAGTATGAGATCAAGCAGATCTCGAGATCTGCTTGATCTCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003255
VALIDATED
TIMP2 MISSION shRNA shRNA Plasmid DNA
TIMP metallopeptidase inhibitor 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003255.4-426s21c1
Sequence:CCGGGATGTAGTGATCAGGGCCAAACTCGAGTTTGGCCCTGATCACTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003255.4-866s21c1
Sequence:CCGGCAAGTTCTTCGCCTGCATCAACTCGAGTTGATGCAGGCGAAGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003255.4-479s21c1
Sequence:CCGGCGACATTTATGGCAACCCTATCTCGAGATAGGGTTGCCATAAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003255.4-509s21c1
Sequence:CCGGCCAGTATGAGATCAAGCAGATCTCGAGATCTGCTTGATCTCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003255.4-546s21c1
Sequence:CCGGCCTGAGAAGGATATAGAGTTTCTCGAGAAACTCTATATCCTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003255.2-479s1c1
Sequence:CCGGCGACATTTATGGCAACCCTATCTCGAGATAGGGTTGCCATAAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003255.2-866s1c1
Sequence:CCGGCAAGTTCTTCGCCTGCATCAACTCGAGTTGATGCAGGCGAAGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003255.2-546s1c1
Sequence:CCGGCCTGAGAAGGATATAGAGTTTCTCGAGAAACTCTATATCCTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003255.2-426s1c1
Sequence:CCGGGATGTAGTGATCAGGGCCAAACTCGAGTTTGGCCCTGATCACTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003255.2-509s1c1
Sequence:CCGGCCAGTATGAGATCAAGCAGATCTCGAGATCTGCTTGATCTCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003255
VALIDATED
TIMP2 MISSION shRNA Lentiviral Transduction Particles
TIMP metallopeptidase inhibitor 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003255.4-426s21c1
Sequence:CCGGGATGTAGTGATCAGGGCCAAACTCGAGTTTGGCCCTGATCACTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003255.4-866s21c1
Sequence:CCGGCAAGTTCTTCGCCTGCATCAACTCGAGTTGATGCAGGCGAAGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003255.4-479s21c1
Sequence:CCGGCGACATTTATGGCAACCCTATCTCGAGATAGGGTTGCCATAAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003255.4-509s21c1
Sequence:CCGGCCAGTATGAGATCAAGCAGATCTCGAGATCTGCTTGATCTCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003255.4-546s21c1
Sequence:CCGGCCTGAGAAGGATATAGAGTTTCTCGAGAAACTCTATATCCTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003255.2-479s1c1
Sequence:CCGGCGACATTTATGGCAACCCTATCTCGAGATAGGGTTGCCATAAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003255.2-866s1c1
Sequence:CCGGCAAGTTCTTCGCCTGCATCAACTCGAGTTGATGCAGGCGAAGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003255.2-546s1c1
Sequence:CCGGCCTGAGAAGGATATAGAGTTTCTCGAGAAACTCTATATCCTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003255.2-426s1c1
Sequence:CCGGGATGTAGTGATCAGGGCCAAACTCGAGTTTGGCCCTGATCACTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003255.2-509s1c1
Sequence:CCGGCCAGTATGAGATCAAGCAGATCTCGAGATCTGCTTGATCTCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011594
VALIDATED
TIMP2 MISSION shRNA Bacterial Glycerol Stock
TIMP metallopeptidase inhibitor 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011594.3-565s21c1
Sequence:CCGGCCTGACAAAGACATCGAGTTTCTCGAGAAACTCGATGTCTTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011594.3-726s21c1
Sequence:CCGGGCTTAGCATCACCCAGAAGAACTCGAGTTCTTCTGGGTGATGCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011594.3-895s21c1
Sequence:CCGGGCCTGCATCAAGAGAAGTGATCTCGAGATCACTTCTCTTGATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011594.3-492s21c1
Sequence:CCGGCGGGAATGACATCTATGGCAACTCGAGTTGCCATAGATGTCATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011594.2-389s1c1
Sequence:CCGGCGGGAATGACATCTATGGCAACTCGAGTTGCCATAGATGTCATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011594.2-623s1c1
Sequence:CCGGGCTTAGCATCACCCAGAAGAACTCGAGTTCTTCTGGGTGATGCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011594.2-2370s1c1
Sequence:CCGGCCCTGTCCTAACCATCAGAAACTCGAGTTTCTGATGGTTAGGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011594.2-792s1c1
Sequence:CCGGGCCTGCATCAAGAGAAGTGATCTCGAGATCACTTCTCTTGATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011594.2-462s1c1
Sequence:CCGGCCTGACAAAGACATCGAGTTTCTCGAGAAACTCGATGTCTTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011594
VALIDATED
TIMP2 MISSION shRNA shRNA Plasmid DNA
TIMP metallopeptidase inhibitor 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011594.3-565s21c1
Sequence:CCGGCCTGACAAAGACATCGAGTTTCTCGAGAAACTCGATGTCTTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011594.3-726s21c1
Sequence:CCGGGCTTAGCATCACCCAGAAGAACTCGAGTTCTTCTGGGTGATGCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011594.3-895s21c1
Sequence:CCGGGCCTGCATCAAGAGAAGTGATCTCGAGATCACTTCTCTTGATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011594.3-492s21c1
Sequence:CCGGCGGGAATGACATCTATGGCAACTCGAGTTGCCATAGATGTCATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011594.2-389s1c1
Sequence:CCGGCGGGAATGACATCTATGGCAACTCGAGTTGCCATAGATGTCATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011594.2-623s1c1
Sequence:CCGGGCTTAGCATCACCCAGAAGAACTCGAGTTCTTCTGGGTGATGCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011594.2-2370s1c1
Sequence:CCGGCCCTGTCCTAACCATCAGAAACTCGAGTTTCTGATGGTTAGGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011594.2-792s1c1
Sequence:CCGGGCCTGCATCAAGAGAAGTGATCTCGAGATCACTTCTCTTGATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011594.2-462s1c1
Sequence:CCGGCCTGACAAAGACATCGAGTTTCTCGAGAAACTCGATGTCTTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011594
VALIDATED
TIMP2 MISSION shRNA Lentiviral Transduction Particles
TIMP metallopeptidase inhibitor 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011594.3-565s21c1
Sequence:CCGGCCTGACAAAGACATCGAGTTTCTCGAGAAACTCGATGTCTTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011594.3-726s21c1
Sequence:CCGGGCTTAGCATCACCCAGAAGAACTCGAGTTCTTCTGGGTGATGCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011594.3-895s21c1
Sequence:CCGGGCCTGCATCAAGAGAAGTGATCTCGAGATCACTTCTCTTGATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011594.3-492s21c1
Sequence:CCGGCGGGAATGACATCTATGGCAACTCGAGTTGCCATAGATGTCATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011594.2-389s1c1
Sequence:CCGGCGGGAATGACATCTATGGCAACTCGAGTTGCCATAGATGTCATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011594.2-623s1c1
Sequence:CCGGGCTTAGCATCACCCAGAAGAACTCGAGTTCTTCTGGGTGATGCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011594.2-2370s1c1
Sequence:CCGGCCCTGTCCTAACCATCAGAAACTCGAGTTTCTGATGGTTAGGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011594.2-792s1c1
Sequence:CCGGGCCTGCATCAAGAGAAGTGATCTCGAGATCACTTCTCTTGATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011594.2-462s1c1
Sequence:CCGGCCTGACAAAGACATCGAGTTTCTCGAGAAACTCGATGTCTTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks