EMAIL THIS PAGE TO A FRIEND

TIMP3

TIMP metallopeptidase inhibitor 3

Synonyms: HSMRK222 K222 K222TA2 SFD
UniProtKB ID: P35625, B2RBY9, Q5THV4, Q9UC74, Q9UGS2
Gene ID:
Human(7078) Summary: This gene belongs to the TIMP gene family. The proteins encoded by this gene family are inhibitors of the matrix metalloproteinases, a group of peptidases involved in degradation of the extracellular matrix (ECM). Expression of this gene is induced in response to mitogenic stimulation and this netrin domain-containing protein is localized to the ECM. Mutations in this gene have been associated with the autosomal dominant disorder Sorsby's fundus dystrophy. [provided by RefSeq, Jul 2008]
Mouse(21859) tissue inhibitor of metalloproteinase 3
Rat(25358) TIMP metallopeptidase inhibitor 3
chicken(396483) TIMP metallopeptidase inhibitor 3
domestic cat(101091215) TIMP metallopeptidase inhibitor 3
Horse(100033947) TIMP metallopeptidase inhibitor 3
dog(481289) TIMP metallopeptidase inhibitor 3
cow(282094) TIMP metallopeptidase inhibitor 3
sheep(100217407) TIMP metallopeptidase inhibitor 3
Domestic Rabbit(100008690) TIMP metallopeptidase inhibitor 3
naked mole-rat(101714710) TIMP metallopeptidase inhibitor 3
domestic guinea pig(100735789) TIMP metallopeptidase inhibitor 3
252 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1747 Human TIMP-3 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000362 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000362 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000362 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011595 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011595 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011595 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU007051 MISSION® esiRNA esiRNA targeting mouse Timp3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000362 Rosetta Predictions human pricing
NM_012886 Rosetta Predictions rat pricing
NM_011595 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000362 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106686 predicted 1873
2 SASI_Hs02_00302411 predicted 1600
3 SASI_Hs01_00106687 predicted 2146
4 SASI_Hs01_00106688 predicted 2261
5 SASI_Hs01_00106689 predicted 1632
6 SASI_Hs01_00106690 predicted 1627
7 SASI_Hs01_00106691 predicted 2068
8 SASI_Hs02_00302412 predicted 1606
9 SASI_Hs01_00106692 predicted 1592
10 SASI_Hs01_00106693 predicted 2096
11 SASI_Hs01_00106694 predicted 2283
12 SASI_Hs01_00106695 predicted 1510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012886 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030228 predicted 730
2 SASI_Rn01_00030231 predicted 1038
3 SASI_Rn01_00030232 predicted 1321
4 SASI_Rn01_00030234 predicted 490
5 SASI_Rn02_00260398 predicted 1424
6 SASI_Rn01_00030235 predicted 1185
7 SASI_Rn01_00030236 predicted 600
8 SASI_Rn01_00030237 predicted 813
9 SASI_Rn02_00260399 predicted 1160
10 SASI_Rn02_00260400 predicted 767
11 SASI_Rn01_00030229 predicted 1296
12 SASI_Rn01_00030230 predicted 1236
13 SASI_Rn01_00030233 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011595 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321005 predicted 858
2 SASI_Mm01_00102066 predicted 890
3 SASI_Mm01_00102065 predicted 1326
4 SASI_Mm02_00321006 predicted 1563
5 SASI_Mm01_00102067 predicted 702
6 SASI_Mm01_00102068 predicted 1483
7 SASI_Mm02_00321007 predicted 1326
8 SASI_Mm02_00321008 predicted 1406
9 SASI_Mm01_00102070 predicted 711
10 SASI_Mm01_00102071 predicted 1506
11 SASI_Mm01_00102064 predicted 1443
12 SASI_Mm01_00102069 predicted 1288
13 SASI_Mm01_00102072 predicted 1087
14 SASI_Mm01_00102073 predicted 640
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000362
TIMP3 MISSION shRNA Bacterial Glycerol Stock
TIMP metallopeptidase inhibitor 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000362.3-1608s1c1
Sequence:CCGGCCTGGGTTGTAACTGCAAGATCTCGAGATCTTGCAGTTACAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000362.3-1449s1c1
Sequence:CCGGCGAGAGTCTCTGTGGCCTTAACTCGAGTTAAGGCCACAGAGACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000362.3-1509s1c1
Sequence:CCGGCGTCTATGATGGCAAGATGTACTCGAGTACATCTTGCCATCATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000362.3-1386s1c1
Sequence:CCGGGATGAAGATGTACCGAGGCTTCTCGAGAAGCCTCGGTACATCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000362.3-1689s1c1
Sequence:CCGGCATGCTCTCCAATTTCGGTTACTCGAGTAACCGAAATTGGAGAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000362.4-1932s21c1
Sequence:CCGGTTAGCACTTGGAACATTTAAACTCGAGTTTAAATGTTCCAAGTGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000362.4-2089s21c1
Sequence:CCGGTATTCCTCTTCTTCGTGATAACTCGAGTTATCACGAAGAAGAGGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000362.4-1417s21c1
Sequence:CCGGCCATGTGCAGTACATCCATACCTCGAGGTATGGATGTACTGCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000362
TIMP3 MISSION shRNA shRNA Plasmid DNA
TIMP metallopeptidase inhibitor 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000362.3-1608s1c1
Sequence:CCGGCCTGGGTTGTAACTGCAAGATCTCGAGATCTTGCAGTTACAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000362.3-1449s1c1
Sequence:CCGGCGAGAGTCTCTGTGGCCTTAACTCGAGTTAAGGCCACAGAGACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000362.3-1509s1c1
Sequence:CCGGCGTCTATGATGGCAAGATGTACTCGAGTACATCTTGCCATCATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000362.3-1386s1c1
Sequence:CCGGGATGAAGATGTACCGAGGCTTCTCGAGAAGCCTCGGTACATCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000362.3-1689s1c1
Sequence:CCGGCATGCTCTCCAATTTCGGTTACTCGAGTAACCGAAATTGGAGAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000362.4-1932s21c1
Sequence:CCGGTTAGCACTTGGAACATTTAAACTCGAGTTTAAATGTTCCAAGTGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000362.4-2089s21c1
Sequence:CCGGTATTCCTCTTCTTCGTGATAACTCGAGTTATCACGAAGAAGAGGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000362.4-1417s21c1
Sequence:CCGGCCATGTGCAGTACATCCATACCTCGAGGTATGGATGTACTGCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000362
TIMP3 MISSION shRNA Lentiviral Transduction Particles
TIMP metallopeptidase inhibitor 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000362.3-1608s1c1
Sequence:CCGGCCTGGGTTGTAACTGCAAGATCTCGAGATCTTGCAGTTACAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000362.3-1449s1c1
Sequence:CCGGCGAGAGTCTCTGTGGCCTTAACTCGAGTTAAGGCCACAGAGACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000362.3-1509s1c1
Sequence:CCGGCGTCTATGATGGCAAGATGTACTCGAGTACATCTTGCCATCATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000362.3-1386s1c1
Sequence:CCGGGATGAAGATGTACCGAGGCTTCTCGAGAAGCCTCGGTACATCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000362.3-1689s1c1
Sequence:CCGGCATGCTCTCCAATTTCGGTTACTCGAGTAACCGAAATTGGAGAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000362.4-1932s21c1
Sequence:CCGGTTAGCACTTGGAACATTTAAACTCGAGTTTAAATGTTCCAAGTGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000362.4-2089s21c1
Sequence:CCGGTATTCCTCTTCTTCGTGATAACTCGAGTTATCACGAAGAAGAGGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000362.4-1417s21c1
Sequence:CCGGCCATGTGCAGTACATCCATACCTCGAGGTATGGATGTACTGCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011595
VALIDATED
TIMP3 MISSION shRNA Bacterial Glycerol Stock
TIMP metallopeptidase inhibitor 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011595.1-762s1c1
Sequence:CCGGCCTGCTACTACTTGCCTTGTTCTCGAGAACAAGGCAAGTAGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011595.1-490s1c1
Sequence:CCGGCACTCTGGTCTACACTATTAACTCGAGTTAATAGTGTAGACCAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011595.1-811s1c1
Sequence:CCGGGACCGACATGCTCTCCAATTTCTCGAGAAATTGGAGAGCATGTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011595.1-634s1c1
Sequence:CCGGGCGCGTGTATGAAGGCAAGATCTCGAGATCTTGCCTTCATACACGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011595.1-736s1c1
Sequence:CCGGCCTGGGTTGCAATTGCAAGATCTCGAGATCTTGCAATTGCAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011595.2-888s21c1
Sequence:CCGGCCTGCTACTACTTGCCTTGTTCTCGAGAACAAGGCAAGTAGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011595.2-760s21c1
Sequence:CCGGGCGCGTGTATGAAGGCAAGATCTCGAGATCTTGCCTTCATACACGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011595.2-937s21c1
Sequence:CCGGGACCGACATGCTCTCCAATTTCTCGAGAAATTGGAGAGCATGTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011595.2-862s21c1
Sequence:CCGGCCTGGGTTGCAATTGCAAGATCTCGAGATCTTGCAATTGCAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011595
VALIDATED
TIMP3 MISSION shRNA shRNA Plasmid DNA
TIMP metallopeptidase inhibitor 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011595.1-762s1c1
Sequence:CCGGCCTGCTACTACTTGCCTTGTTCTCGAGAACAAGGCAAGTAGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011595.1-490s1c1
Sequence:CCGGCACTCTGGTCTACACTATTAACTCGAGTTAATAGTGTAGACCAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011595.1-811s1c1
Sequence:CCGGGACCGACATGCTCTCCAATTTCTCGAGAAATTGGAGAGCATGTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011595.1-634s1c1
Sequence:CCGGGCGCGTGTATGAAGGCAAGATCTCGAGATCTTGCCTTCATACACGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011595.1-736s1c1
Sequence:CCGGCCTGGGTTGCAATTGCAAGATCTCGAGATCTTGCAATTGCAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011595.2-888s21c1
Sequence:CCGGCCTGCTACTACTTGCCTTGTTCTCGAGAACAAGGCAAGTAGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011595.2-760s21c1
Sequence:CCGGGCGCGTGTATGAAGGCAAGATCTCGAGATCTTGCCTTCATACACGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011595.2-937s21c1
Sequence:CCGGGACCGACATGCTCTCCAATTTCTCGAGAAATTGGAGAGCATGTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011595.2-862s21c1
Sequence:CCGGCCTGGGTTGCAATTGCAAGATCTCGAGATCTTGCAATTGCAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011595
VALIDATED
TIMP3 MISSION shRNA Lentiviral Transduction Particles
TIMP metallopeptidase inhibitor 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011595.1-762s1c1
Sequence:CCGGCCTGCTACTACTTGCCTTGTTCTCGAGAACAAGGCAAGTAGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011595.1-490s1c1
Sequence:CCGGCACTCTGGTCTACACTATTAACTCGAGTTAATAGTGTAGACCAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011595.1-811s1c1
Sequence:CCGGGACCGACATGCTCTCCAATTTCTCGAGAAATTGGAGAGCATGTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011595.1-634s1c1
Sequence:CCGGGCGCGTGTATGAAGGCAAGATCTCGAGATCTTGCCTTCATACACGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011595.1-736s1c1
Sequence:CCGGCCTGGGTTGCAATTGCAAGATCTCGAGATCTTGCAATTGCAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011595.2-888s21c1
Sequence:CCGGCCTGCTACTACTTGCCTTGTTCTCGAGAACAAGGCAAGTAGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011595.2-760s21c1
Sequence:CCGGGCGCGTGTATGAAGGCAAGATCTCGAGATCTTGCCTTCATACACGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011595.2-937s21c1
Sequence:CCGGGACCGACATGCTCTCCAATTTCTCGAGAAATTGGAGAGCATGTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011595.2-862s21c1
Sequence:CCGGCCTGGGTTGCAATTGCAAGATCTCGAGATCTTGCAATTGCAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks