EMAIL THIS PAGE TO A FRIEND

TIMP4

TIMP metallopeptidase inhibitor 4

UniProtKB ID: Q99727, B2R7K6
Gene ID:
Human(7079) Summary: This gene belongs to the TIMP gene family. The proteins encoded by this gene family are inhibitors of the matrix metalloproteinases, a group of peptidases involved in degradation of the extracellular matrix. The secreted, netrin domain-containing protein encoded by this gene is involved in regulation of platelet aggregation and recruitment and may play role in hormonal regulation and endometrial tissue remodeling. [provided by RefSeq, Jul 2008]
Mouse(110595) tissue inhibitor of metalloproteinase 4
Rat(680130) tissue inhibitor of metalloproteinase 4
domestic guinea pig(100725435) TIMP metallopeptidase inhibitor 4
naked mole-rat(101712642) TIMP metallopeptidase inhibitor 4
Domestic Rabbit(100008691) TIMP metallopeptidase inhibitor 4
cow(317694) TIMP metallopeptidase inhibitor 4
chicken(768711) TIMP metallopeptidase inhibitor 4
domestic cat(101094660) TIMP metallopeptidase inhibitor 4
dog(100688494) TIMP metallopeptidase inhibitor 4
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003256 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003256 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003256 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080639 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080639 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080639 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003256 Rosetta Predictions human pricing
NM_001109393 Rosetta Predictions rat pricing
NM_080639 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003256 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234746 predicted 1065
2 SASI_Hs01_00234747 predicted 729
3 SASI_Hs01_00234748 predicted 881
4 SASI_Hs02_00335301 predicted 606
5 SASI_Hs01_00234750 predicted 1079
6 SASI_Hs01_00234751 predicted 634
7 SASI_Hs01_00234752 predicted 1069
8 SASI_Hs01_00234753 predicted 865
9 SASI_Hs01_00234754 predicted 946
10 SASI_Hs01_00234755 predicted 785
11 SASI_Hs01_00234749 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109393 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247976 predicted 1045
2 SASI_Rn02_00247977 predicted 1124
3 SASI_Rn02_00247978 predicted 570
4 SASI_Rn02_00247979 predicted 1295
5 SASI_Rn02_00247980 predicted 1241
6 SASI_Rn02_00247981 predicted 1115
7 SASI_Rn02_00247982 predicted 1477
8 SASI_Rn02_00247983 predicted 1215
9 SASI_Rn02_00247984 predicted 489
10 SASI_Rn02_00247985 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080639 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194318 predicted 373
2 SASI_Mm02_00338189 predicted 821
3 SASI_Mm01_00194326 predicted 203
4 SASI_Mm02_00338190 predicted 523
5 SASI_Mm02_00338191 predicted 249
6 SASI_Mm02_00338192 predicted 284
7 SASI_Mm02_00338193 predicted 785
8 SASI_Mm02_00338194 predicted 339
9 SASI_Mm02_00338195 predicted 758
10 SASI_Mm02_00338196 predicted 762
11 SASI_Mm01_00194319 predicted 508
12 SASI_Mm01_00194320 predicted 533
13 SASI_Mm01_00194321 predicted 360
14 SASI_Mm01_00194322 predicted 942
15 SASI_Mm01_00194323 predicted 827
16 SASI_Mm01_00194324 predicted 691
17 SASI_Mm01_00194325 predicted 201
18 SASI_Mm01_00194327 predicted 794
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003256
TIMP4 MISSION shRNA Bacterial Glycerol Stock
TIMP metallopeptidase inhibitor 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003256.2-688s21c1
Sequence:CCGGCATCCATCTGTGCAACTACATCTCGAGATGTAGTTGCACAGATGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003256.2-440s21c1
Sequence:CCGGGCACTTGTGATTCGGGCCAAACTCGAGTTTGGCCCGAATCACAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003256.2-944s21c1
Sequence:CCGGCCTCTCAGGAAGGAGTTTGTTCTCGAGAACAAACTCCTTCCTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003256.2-520s21c1
Sequence:CCGGCCGGTATGAAATCAAACAGATCTCGAGATCTGTTTGATTTCATACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003256.1-272s1c1
Sequence:CCGGCCGGTATGAAATCAAACAGATCTCGAGATCTGTTTGATTTCATACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003256.1-329s1c1
Sequence:CCGGTCAGTATATCTATACGCCTTTCTCGAGAAAGGCGTATAGATATACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003256.1-440s1c1
Sequence:CCGGCATCCATCTGTGCAACTACATCTCGAGATGTAGTTGCACAGATGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003256.1-192s1c1
Sequence:CCGGGCACTTGTGATTCGGGCCAAACTCGAGTTTGGCCCGAATCACAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003256.1-696s1c1
Sequence:CCGGCCTCTCAGGAAGGAGTTTGTTCTCGAGAACAAACTCCTTCCTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003256
TIMP4 MISSION shRNA shRNA Plasmid DNA
TIMP metallopeptidase inhibitor 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003256.2-688s21c1
Sequence:CCGGCATCCATCTGTGCAACTACATCTCGAGATGTAGTTGCACAGATGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003256.2-440s21c1
Sequence:CCGGGCACTTGTGATTCGGGCCAAACTCGAGTTTGGCCCGAATCACAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003256.2-944s21c1
Sequence:CCGGCCTCTCAGGAAGGAGTTTGTTCTCGAGAACAAACTCCTTCCTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003256.2-520s21c1
Sequence:CCGGCCGGTATGAAATCAAACAGATCTCGAGATCTGTTTGATTTCATACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003256.1-272s1c1
Sequence:CCGGCCGGTATGAAATCAAACAGATCTCGAGATCTGTTTGATTTCATACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003256.1-329s1c1
Sequence:CCGGTCAGTATATCTATACGCCTTTCTCGAGAAAGGCGTATAGATATACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003256.1-440s1c1
Sequence:CCGGCATCCATCTGTGCAACTACATCTCGAGATGTAGTTGCACAGATGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003256.1-192s1c1
Sequence:CCGGGCACTTGTGATTCGGGCCAAACTCGAGTTTGGCCCGAATCACAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003256.1-696s1c1
Sequence:CCGGCCTCTCAGGAAGGAGTTTGTTCTCGAGAACAAACTCCTTCCTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003256
TIMP4 MISSION shRNA Lentiviral Transduction Particles
TIMP metallopeptidase inhibitor 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003256.2-688s21c1
Sequence:CCGGCATCCATCTGTGCAACTACATCTCGAGATGTAGTTGCACAGATGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003256.2-440s21c1
Sequence:CCGGGCACTTGTGATTCGGGCCAAACTCGAGTTTGGCCCGAATCACAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003256.2-944s21c1
Sequence:CCGGCCTCTCAGGAAGGAGTTTGTTCTCGAGAACAAACTCCTTCCTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003256.2-520s21c1
Sequence:CCGGCCGGTATGAAATCAAACAGATCTCGAGATCTGTTTGATTTCATACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003256.1-272s1c1
Sequence:CCGGCCGGTATGAAATCAAACAGATCTCGAGATCTGTTTGATTTCATACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003256.1-329s1c1
Sequence:CCGGTCAGTATATCTATACGCCTTTCTCGAGAAAGGCGTATAGATATACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003256.1-440s1c1
Sequence:CCGGCATCCATCTGTGCAACTACATCTCGAGATGTAGTTGCACAGATGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003256.1-192s1c1
Sequence:CCGGGCACTTGTGATTCGGGCCAAACTCGAGTTTGGCCCGAATCACAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003256.1-696s1c1
Sequence:CCGGCCTCTCAGGAAGGAGTTTGTTCTCGAGAACAAACTCCTTCCTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080639
TIMP4 MISSION shRNA Bacterial Glycerol Stock
TIMP metallopeptidase inhibitor 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080639.2-927s1c1
Sequence:CCGGGCTCACAACTTGTCAAGGGTTCTCGAGAACCCTTGACAAGTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080639.2-510s1c1
Sequence:CCGGGCCTGAATCATCACTACCACACTCGAGTGTGGTAGTGATGATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080639.2-203s1c1
Sequence:CCGGGCTCTAGTGATACGGGCCAAACTCGAGTTTGGCCCGTATCACTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080639.2-646s1c1
Sequence:CCGGCCAGCACTATGTCTGCATGAACTCGAGTTCATGCAGACATAGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080639.2-424s1c1
Sequence:CCGGCCAGATTCTCAGTGATGGAAACTCGAGTTTCCATCACTGAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080639
TIMP4 MISSION shRNA shRNA Plasmid DNA
TIMP metallopeptidase inhibitor 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080639.2-927s1c1
Sequence:CCGGGCTCACAACTTGTCAAGGGTTCTCGAGAACCCTTGACAAGTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080639.2-510s1c1
Sequence:CCGGGCCTGAATCATCACTACCACACTCGAGTGTGGTAGTGATGATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080639.2-203s1c1
Sequence:CCGGGCTCTAGTGATACGGGCCAAACTCGAGTTTGGCCCGTATCACTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080639.2-646s1c1
Sequence:CCGGCCAGCACTATGTCTGCATGAACTCGAGTTCATGCAGACATAGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080639.2-424s1c1
Sequence:CCGGCCAGATTCTCAGTGATGGAAACTCGAGTTTCCATCACTGAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080639
TIMP4 MISSION shRNA Lentiviral Transduction Particles
TIMP metallopeptidase inhibitor 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080639.2-927s1c1
Sequence:CCGGGCTCACAACTTGTCAAGGGTTCTCGAGAACCCTTGACAAGTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080639.2-510s1c1
Sequence:CCGGGCCTGAATCATCACTACCACACTCGAGTGTGGTAGTGATGATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080639.2-203s1c1
Sequence:CCGGGCTCTAGTGATACGGGCCAAACTCGAGTTTGGCCCGTATCACTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080639.2-646s1c1
Sequence:CCGGCCAGCACTATGTCTGCATGAACTCGAGTTCATGCAGACATAGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080639.2-424s1c1
Sequence:CCGGCCAGATTCTCAGTGATGGAAACTCGAGTTTCCATCACTGAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks