EMAIL THIS PAGE TO A FRIEND

TINAG

tubulointerstitial nephritis antigen

Synonyms: TIN-AG
UniProtKB ID: Q9UJW2, Q5T467, Q9UJW1, Q9ULZ4
Gene ID:
Human(27283) Summary: This gene encodes a glycoprotein that is restricted within the kidney to the basement membranes underlying the epithelium of Bowman's capsule and proximal and distal tubules. Autoantibodies against this protein are found in sera of patients with tubulointerstital nephritis, membranous nephropathy and anti-glomerular basement membrane nephritis. Ontogeny studies suggest that the expression of this antigen is developmentally regulated in a precise spatial and temporal pattern throughout nephrogenesis. [provided by RefSeq, Nov 2011]
Mouse(26944) tubulointerstitial nephritis antigen
Rat(300846) tubulointerstitial nephritis antigen
chicken(421888) tubulointerstitial nephritis antigen
dog(481848) tubulointerstitial nephritis antigen
domestic cat(101087743) tubulointerstitial nephritis antigen
cow(512517) tubulointerstitial nephritis antigen
sheep(101108430) tubulointerstitial nephritis antigen
Domestic Rabbit(100009584) tubulointerstitial nephritis antigen
naked mole-rat(101721602) tubulointerstitial nephritis antigen
domestic guinea pig(100730308) tubulointerstitial nephritis antigen
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014464 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014464 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014464 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_012033 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012033 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012033 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070711 MISSION® esiRNA esiRNA human TINAG (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014464 Rosetta Predictions human pricing
NM_001005549 Rosetta Predictions rat pricing
NM_012033 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145773 predicted 233
2 SASI_Hs01_00145776 predicted 498
3 SASI_Hs01_00145777 predicted 497
4 SASI_Hs01_00145778 predicted 835
5 SASI_Hs01_00145779 predicted 1313
6 SASI_Hs01_00145780 predicted 1475
7 SASI_Hs01_00145781 predicted 578
8 SASI_Hs01_00145782 predicted 412
9 SASI_Hs02_00345685 predicted 324
10 SASI_Hs02_00345686 predicted 302
11 SASI_Hs01_00145774 predicted 1287
12 SASI_Hs01_00145775 predicted 1282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005549 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198408 predicted 1185
2 SASI_Rn01_00033132 predicted 601
3 SASI_Rn01_00033133 predicted 974
4 SASI_Rn01_00033134 predicted 1160
5 SASI_Rn01_00033135 predicted 431
6 SASI_Rn01_00033136 predicted 496
7 SASI_Rn01_00033137 predicted 324
8 SASI_Rn01_00033138 predicted 1112
9 SASI_Rn01_00033140 predicted 272
10 SASI_Rn01_00033141 predicted 523
11 SASI_Rn01_00033139 predicted 1074
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012033 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161122 predicted 540
2 SASI_Mm01_00161123 predicted 391
3 SASI_Mm01_00161124 predicted 706
4 SASI_Mm01_00161126 predicted 395
5 SASI_Mm01_00161127 predicted 297
6 SASI_Mm01_00161128 predicted 458
7 SASI_Mm01_00161129 predicted 496
8 SASI_Mm01_00161130 predicted 1041
9 SASI_Mm01_00161131 predicted 238
10 SASI_Mm02_00322001 predicted 379
11 SASI_Mm01_00161125 predicted 966
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014464
TINAG MISSION shRNA Bacterial Glycerol Stock
tubulointerstitial nephritis antigen
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014464.1-360s1c1
Sequence:CCGGGCTTCAAAGATGGTCAACATTCTCGAGAATGTTGACCATCTTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014464.1-763s1c1
Sequence:CCGGCCGAATAGCAATTCAGTCTAACTCGAGTTAGACTGAATTGCTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014464.1-157s1c1
Sequence:CCGGCCAAGGGCAATACTGTAGAAACTCGAGTTTCTACAGTATTGCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014464.1-1141s1c1
Sequence:CCGGCCATGAAGATTTCTTCCATTACTCGAGTAATGGAAGAAATCTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014464.1-462s1c1
Sequence:CCGGGCCTTGTTCGTCCAGAATTAACTCGAGTTAATTCTGGACGAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014464.3-230s21c1
Sequence:CCGGAGTGGACCTAGAGGCTTATTTCTCGAGAAATAAGCCTCTAGGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014464.3-932s21c1
Sequence:CCGGTCGATACACGGCCAATCTATCCTCGAGGATAGATTGGCCGTGTATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014464
TINAG MISSION shRNA shRNA Plasmid DNA
tubulointerstitial nephritis antigen
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014464.1-360s1c1
Sequence:CCGGGCTTCAAAGATGGTCAACATTCTCGAGAATGTTGACCATCTTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014464.1-763s1c1
Sequence:CCGGCCGAATAGCAATTCAGTCTAACTCGAGTTAGACTGAATTGCTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014464.1-157s1c1
Sequence:CCGGCCAAGGGCAATACTGTAGAAACTCGAGTTTCTACAGTATTGCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014464.1-1141s1c1
Sequence:CCGGCCATGAAGATTTCTTCCATTACTCGAGTAATGGAAGAAATCTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014464.1-462s1c1
Sequence:CCGGGCCTTGTTCGTCCAGAATTAACTCGAGTTAATTCTGGACGAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014464.3-230s21c1
Sequence:CCGGAGTGGACCTAGAGGCTTATTTCTCGAGAAATAAGCCTCTAGGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014464.3-932s21c1
Sequence:CCGGTCGATACACGGCCAATCTATCCTCGAGGATAGATTGGCCGTGTATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014464
TINAG MISSION shRNA Lentiviral Transduction Particles
tubulointerstitial nephritis antigen
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014464.1-360s1c1
Sequence:CCGGGCTTCAAAGATGGTCAACATTCTCGAGAATGTTGACCATCTTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014464.1-763s1c1
Sequence:CCGGCCGAATAGCAATTCAGTCTAACTCGAGTTAGACTGAATTGCTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014464.1-157s1c1
Sequence:CCGGCCAAGGGCAATACTGTAGAAACTCGAGTTTCTACAGTATTGCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014464.1-1141s1c1
Sequence:CCGGCCATGAAGATTTCTTCCATTACTCGAGTAATGGAAGAAATCTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014464.1-462s1c1
Sequence:CCGGGCCTTGTTCGTCCAGAATTAACTCGAGTTAATTCTGGACGAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014464.3-230s21c1
Sequence:CCGGAGTGGACCTAGAGGCTTATTTCTCGAGAAATAAGCCTCTAGGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014464.3-932s21c1
Sequence:CCGGTCGATACACGGCCAATCTATCCTCGAGGATAGATTGGCCGTGTATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012033
VALIDATED
TINAG MISSION shRNA Bacterial Glycerol Stock
tubulointerstitial nephritis antigen
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012033.2-1057s1c1
Sequence:CCGGCCAACAGGATTTACCAATGTTCTCGAGAACATTGGTAAATCCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012033.2-509s1c1
Sequence:CCGGCCACATCAATAAAGGAGACTACTCGAGTAGTCTCCTTTATTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012033.2-829s1c1
Sequence:CCGGCGCCTCAGAATTTGATCTCTTCTCGAGAAGAGATCAAATTCTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012033.2-1149s1c1
Sequence:CCGGGCCATAATGCAAGTCCATGAACTCGAGTTCATGGACTTGCATTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012033.2-484s1c1
Sequence:CCGGGCCTTGTTCATCCAGAATTAACTCGAGTTAATTCTGGATGAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012033.3-1531s21c1
Sequence:CCGGATGCATTCAAGTAACTCATTACTCGAGTAATGAGTTACTTGAATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012033.3-1422s21c1
Sequence:CCGGTAGGATTCTTCGAGGAGTAAACTCGAGTTTACTCCTCGAAGAATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012033.3-1500s21c1
Sequence:CCGGTGATCCATAGCTATCACATTTCTCGAGAAATGTGATAGCTATGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012033.3-540s21c1
Sequence:CCGGCCTTGTTCATCCAGAATTAATCTCGAGATTAATTCTGGATGAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012033.3-1091s21c1
Sequence:CCGGGTCCCAACAGCTTCGAGAAATCTCGAGATTTCTCGAAGCTGTTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012033
VALIDATED
TINAG MISSION shRNA shRNA Plasmid DNA
tubulointerstitial nephritis antigen
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012033.2-1057s1c1
Sequence:CCGGCCAACAGGATTTACCAATGTTCTCGAGAACATTGGTAAATCCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012033.2-509s1c1
Sequence:CCGGCCACATCAATAAAGGAGACTACTCGAGTAGTCTCCTTTATTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012033.2-829s1c1
Sequence:CCGGCGCCTCAGAATTTGATCTCTTCTCGAGAAGAGATCAAATTCTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012033.2-1149s1c1
Sequence:CCGGGCCATAATGCAAGTCCATGAACTCGAGTTCATGGACTTGCATTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012033.2-484s1c1
Sequence:CCGGGCCTTGTTCATCCAGAATTAACTCGAGTTAATTCTGGATGAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012033.3-1531s21c1
Sequence:CCGGATGCATTCAAGTAACTCATTACTCGAGTAATGAGTTACTTGAATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012033.3-1422s21c1
Sequence:CCGGTAGGATTCTTCGAGGAGTAAACTCGAGTTTACTCCTCGAAGAATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012033.3-1500s21c1
Sequence:CCGGTGATCCATAGCTATCACATTTCTCGAGAAATGTGATAGCTATGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012033.3-540s21c1
Sequence:CCGGCCTTGTTCATCCAGAATTAATCTCGAGATTAATTCTGGATGAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012033.3-1091s21c1
Sequence:CCGGGTCCCAACAGCTTCGAGAAATCTCGAGATTTCTCGAAGCTGTTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012033
VALIDATED
TINAG MISSION shRNA Lentiviral Transduction Particles
tubulointerstitial nephritis antigen
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012033.2-1057s1c1
Sequence:CCGGCCAACAGGATTTACCAATGTTCTCGAGAACATTGGTAAATCCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012033.2-509s1c1
Sequence:CCGGCCACATCAATAAAGGAGACTACTCGAGTAGTCTCCTTTATTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012033.2-829s1c1
Sequence:CCGGCGCCTCAGAATTTGATCTCTTCTCGAGAAGAGATCAAATTCTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012033.2-1149s1c1
Sequence:CCGGGCCATAATGCAAGTCCATGAACTCGAGTTCATGGACTTGCATTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012033.2-484s1c1
Sequence:CCGGGCCTTGTTCATCCAGAATTAACTCGAGTTAATTCTGGATGAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012033.3-1531s21c1
Sequence:CCGGATGCATTCAAGTAACTCATTACTCGAGTAATGAGTTACTTGAATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012033.3-1422s21c1
Sequence:CCGGTAGGATTCTTCGAGGAGTAAACTCGAGTTTACTCCTCGAAGAATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012033.3-1500s21c1
Sequence:CCGGTGATCCATAGCTATCACATTTCTCGAGAAATGTGATAGCTATGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012033.3-540s21c1
Sequence:CCGGCCTTGTTCATCCAGAATTAATCTCGAGATTAATTCTGGATGAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012033.3-1091s21c1
Sequence:CCGGGTCCCAACAGCTTCGAGAAATCTCGAGATTTCTCGAAGCTGTTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks