EMAIL THIS PAGE TO A FRIEND

TINAGL1

tubulointerstitial nephritis antigen-like 1

Synonyms: ARG1 LCN7 LIECG3 TINAGRP
Gene ID:
Human(64129) Summary: The protein encoded by this gene is similar in sequence to tubulointerstitial nephritis antigen, a secreted glycoprotein that is recognized by antibodies in some types of immune-related tubulointerstitial nephritis. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
Mouse(94242) tubulointerstitial nephritis antigen-like 1
Rat(94174) tubulointerstitial nephritis antigen-like 1
domestic guinea pig(100731845) tubulointerstitial nephritis antigen-like 1
naked mole-rat(101703258) tubulointerstitial nephritis antigen-like 1
Domestic Rabbit(100352544) tubulointerstitial nephritis antigen-like 1
cow(509642) tubulointerstitial nephritis antigen-like 1
sheep(101119187) tubulointerstitial nephritis antigen-like 1
Zebrafish(562116) tubulointerstitial nephritis antigen-like 1
Horse(100056208) tubulointerstitial nephritis antigen-like 1
domestic cat(101101397) tubulointerstitial nephritis antigen-like 1
dog(478155) tubulointerstitial nephritis antigen-like 1
chicken(430648) tubulointerstitial nephritis antigen-like 1
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022164 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022164 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022164 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023476 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023476 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023476 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU076431 MISSION® esiRNA esiRNA human TINAGL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022164 Rosetta Predictions human pricing
NM_053582 Rosetta Predictions rat pricing
NM_023476 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012554 predicted 1272
2 SASI_Hs01_00012558 predicted 1426
3 SASI_Hs01_00012560 predicted 1435
4 SASI_Hs01_00012562 predicted 1235
5 SASI_Hs02_00355596 predicted 1130
6 SASI_Hs01_00012555 predicted 369
7 SASI_Hs01_00012556 predicted 687
8 SASI_Hs01_00012557 predicted 596
9 SASI_Hs01_00012559 predicted 592
10 SASI_Hs01_00012561 predicted 761
11 SASI_Hs01_00012563 predicted 596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053582 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066930 predicted 1052
2 SASI_Rn01_00066931 predicted 1609
3 SASI_Rn01_00066932 predicted 862
4 SASI_Rn01_00066933 predicted 206
5 SASI_Rn01_00066934 predicted 1060
6 SASI_Rn01_00066935 predicted 338
7 SASI_Rn02_00266249 predicted 725
8 SASI_Rn01_00066936 predicted 857
9 SASI_Rn01_00066937 predicted 610
10 SASI_Rn01_00066938 predicted 1415
11 SASI_Rn01_00066939 predicted 1618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023476 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199137 predicted 1272
2 SASI_Mm01_00199138 predicted 935
3 SASI_Mm01_00199139 predicted 784
4 SASI_Mm01_00199144 predicted 1686
5 SASI_Mm01_00199140 predicted 952
6 SASI_Mm01_00199142 predicted 430
7 SASI_Mm01_00199143 predicted 1305
8 SASI_Mm01_00199145 predicted 789
9 SASI_Mm01_00199141 predicted 1085
10 SASI_Mm02_00327133 predicted 1712
11 SASI_Mm01_00199146 predicted 952
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022164
TINAGL1 MISSION shRNA Bacterial Glycerol Stock
tubulointerstitial nephritis antigen-like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022164.2-572s21c1
Sequence:CCGGCCATCAACCAGGGCAACTATGCTCGAGCATAGTTGCCCTGGTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022164.2-443s21c1
Sequence:CCGGTGCATGGAGGTCGTATCTATCCTCGAGGATAGATACGACCTCCATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022164.2-1364s21c1
Sequence:CCGGCAGATGGAAGGACGCTCAAATCTCGAGATTTGAGCGTCCTTCCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022164.1-1914s1c1
Sequence:CCGGCCTCTCAAGTAGCTGGGACTACTCGAGTAGTCCCAGCTACTTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022164.1-609s1c1
Sequence:CCGGCGGTCATGAACATGCATGAAACTCGAGTTTCATGCATGTTCATGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022164.1-1174s1c1
Sequence:CCGGCCTATACAAGGGAGGCATCTACTCGAGTAGATGCCTCCCTTGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022164.1-608s1c1
Sequence:CCGGTCGGTCATGAACATGCATGAACTCGAGTTCATGCATGTTCATGACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022164.1-259s1c1
Sequence:CCGGCATCTGTTACTGTGACCTCTTCTCGAGAAGAGGTCACAGTAACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022164
TINAGL1 MISSION shRNA shRNA Plasmid DNA
tubulointerstitial nephritis antigen-like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022164.2-572s21c1
Sequence:CCGGCCATCAACCAGGGCAACTATGCTCGAGCATAGTTGCCCTGGTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022164.2-443s21c1
Sequence:CCGGTGCATGGAGGTCGTATCTATCCTCGAGGATAGATACGACCTCCATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022164.2-1364s21c1
Sequence:CCGGCAGATGGAAGGACGCTCAAATCTCGAGATTTGAGCGTCCTTCCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022164.1-1914s1c1
Sequence:CCGGCCTCTCAAGTAGCTGGGACTACTCGAGTAGTCCCAGCTACTTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022164.1-609s1c1
Sequence:CCGGCGGTCATGAACATGCATGAAACTCGAGTTTCATGCATGTTCATGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022164.1-1174s1c1
Sequence:CCGGCCTATACAAGGGAGGCATCTACTCGAGTAGATGCCTCCCTTGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022164.1-608s1c1
Sequence:CCGGTCGGTCATGAACATGCATGAACTCGAGTTCATGCATGTTCATGACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022164.1-259s1c1
Sequence:CCGGCATCTGTTACTGTGACCTCTTCTCGAGAAGAGGTCACAGTAACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022164
TINAGL1 MISSION shRNA Lentiviral Transduction Particles
tubulointerstitial nephritis antigen-like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022164.2-572s21c1
Sequence:CCGGCCATCAACCAGGGCAACTATGCTCGAGCATAGTTGCCCTGGTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022164.2-443s21c1
Sequence:CCGGTGCATGGAGGTCGTATCTATCCTCGAGGATAGATACGACCTCCATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022164.2-1364s21c1
Sequence:CCGGCAGATGGAAGGACGCTCAAATCTCGAGATTTGAGCGTCCTTCCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022164.1-1914s1c1
Sequence:CCGGCCTCTCAAGTAGCTGGGACTACTCGAGTAGTCCCAGCTACTTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022164.1-609s1c1
Sequence:CCGGCGGTCATGAACATGCATGAAACTCGAGTTTCATGCATGTTCATGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022164.1-1174s1c1
Sequence:CCGGCCTATACAAGGGAGGCATCTACTCGAGTAGATGCCTCCCTTGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022164.1-608s1c1
Sequence:CCGGTCGGTCATGAACATGCATGAACTCGAGTTCATGCATGTTCATGACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022164.1-259s1c1
Sequence:CCGGCATCTGTTACTGTGACCTCTTCTCGAGAAGAGGTCACAGTAACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023476
VALIDATED
TINAGL1 MISSION shRNA Bacterial Glycerol Stock
tubulointerstitial nephritis antigen-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023476.2-1216s21c1
Sequence:CCGGTCAGGTTGATTCCAACGACATCTCGAGATGTCGTTGGAATCAACCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023476.2-433s21c1
Sequence:CCGGCACCTGTTACTGTGACCTCTTCTCGAGAAGAGGTCACAGTAACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023476.2-1310s21c1
Sequence:CCGGCCTGTTCAAGCACTCATGGAACTCGAGTTCCATGAGTGCTTGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023476.2-969s21c1
Sequence:CCGGGACACATGACACCCATCCTATCTCGAGATAGGATGGGTGTCATGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023476.2-655s21c1
Sequence:CCGGCCCAGACATGATTAAAGCCATCTCGAGATGGCTTTAATCATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023476.1-656s1c1
Sequence:CCGGCCCAGACATGATTAAAGCCATCTCGAGATGGCTTTAATCATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023476.1-434s1c1
Sequence:CCGGCACCTGTTACTGTGACCTCTTCTCGAGAAGAGGTCACAGTAACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023476.1-1217s1c1
Sequence:CCGGTCAGGTTGATTCCAACGACATCTCGAGATGTCGTTGGAATCAACCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023476.1-970s1c1
Sequence:CCGGGACACATGACACCCATCCTATCTCGAGATAGGATGGGTGTCATGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023476.1-1311s1c1
Sequence:CCGGCCTGTTCAAGCACTCATGGAACTCGAGTTCCATGAGTGCTTGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023476
VALIDATED
TINAGL1 MISSION shRNA shRNA Plasmid DNA
tubulointerstitial nephritis antigen-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023476.2-1216s21c1
Sequence:CCGGTCAGGTTGATTCCAACGACATCTCGAGATGTCGTTGGAATCAACCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023476.2-433s21c1
Sequence:CCGGCACCTGTTACTGTGACCTCTTCTCGAGAAGAGGTCACAGTAACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023476.2-1310s21c1
Sequence:CCGGCCTGTTCAAGCACTCATGGAACTCGAGTTCCATGAGTGCTTGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023476.2-969s21c1
Sequence:CCGGGACACATGACACCCATCCTATCTCGAGATAGGATGGGTGTCATGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023476.2-655s21c1
Sequence:CCGGCCCAGACATGATTAAAGCCATCTCGAGATGGCTTTAATCATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023476.1-656s1c1
Sequence:CCGGCCCAGACATGATTAAAGCCATCTCGAGATGGCTTTAATCATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023476.1-434s1c1
Sequence:CCGGCACCTGTTACTGTGACCTCTTCTCGAGAAGAGGTCACAGTAACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023476.1-1217s1c1
Sequence:CCGGTCAGGTTGATTCCAACGACATCTCGAGATGTCGTTGGAATCAACCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023476.1-970s1c1
Sequence:CCGGGACACATGACACCCATCCTATCTCGAGATAGGATGGGTGTCATGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023476.1-1311s1c1
Sequence:CCGGCCTGTTCAAGCACTCATGGAACTCGAGTTCCATGAGTGCTTGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023476
VALIDATED
TINAGL1 MISSION shRNA Lentiviral Transduction Particles
tubulointerstitial nephritis antigen-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023476.2-1216s21c1
Sequence:CCGGTCAGGTTGATTCCAACGACATCTCGAGATGTCGTTGGAATCAACCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023476.2-433s21c1
Sequence:CCGGCACCTGTTACTGTGACCTCTTCTCGAGAAGAGGTCACAGTAACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023476.2-1310s21c1
Sequence:CCGGCCTGTTCAAGCACTCATGGAACTCGAGTTCCATGAGTGCTTGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023476.2-969s21c1
Sequence:CCGGGACACATGACACCCATCCTATCTCGAGATAGGATGGGTGTCATGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023476.2-655s21c1
Sequence:CCGGCCCAGACATGATTAAAGCCATCTCGAGATGGCTTTAATCATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023476.1-656s1c1
Sequence:CCGGCCCAGACATGATTAAAGCCATCTCGAGATGGCTTTAATCATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023476.1-434s1c1
Sequence:CCGGCACCTGTTACTGTGACCTCTTCTCGAGAAGAGGTCACAGTAACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023476.1-1217s1c1
Sequence:CCGGTCAGGTTGATTCCAACGACATCTCGAGATGTCGTTGGAATCAACCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023476.1-970s1c1
Sequence:CCGGGACACATGACACCCATCCTATCTCGAGATAGGATGGGTGTCATGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023476.1-1311s1c1
Sequence:CCGGCCTGTTCAAGCACTCATGGAACTCGAGTTCCATGAGTGCTTGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks