EMAIL THIS PAGE TO A FRIEND

TINCR

tissue differentiation-inducing non-protein coding RNA

Synonyms: LINC00036 NCRNA00036 PLAC2
Species: Human TINCR(257000)
Gene ID:
43 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500572 Anti-PLAC2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunocytochemistry, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153375 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153375 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153375 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153375 Rosetta Predictions human pricing
XR_040439 Rosetta Predictions human pricing
XR_040440 Rosetta Predictions human pricing
XR_040441 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207554 predicted 466
2 SASI_Hs01_00207555 predicted 1234
3 SASI_Hs01_00207556 predicted 506
4 SASI_Hs01_00207557 predicted 1399
5 SASI_Hs01_00207558 predicted 1118
6 SASI_Hs01_00207559 predicted 506
7 SASI_Hs01_00207560 predicted 455
8 SASI_Hs01_00207561 predicted 638
9 SASI_Hs01_00207562 predicted 738
10 SASI_Hs01_00207563 predicted 974
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518891 predicted 356
2 SASI_Hs02_00518892 predicted 543
3 SASI_Hs02_00518893 predicted 1300
4 SASI_Hs02_00518894 predicted 572
5 SASI_Hs02_00518895 predicted 407
6 SASI_Hs02_00518896 predicted 1468
7 SASI_Hs02_00518897 predicted 466
8 SASI_Hs02_00518898 predicted 1180
9 SASI_Hs02_00518899 predicted 402
10 SASI_Hs02_00518900 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518901 predicted 2030
2 SASI_Hs02_00518902 predicted 361
3 SASI_Hs02_00518903 predicted 541
4 SASI_Hs02_00518904 predicted 1304
5 SASI_Hs02_00518905 predicted 578
6 SASI_Hs02_00518906 predicted 1466
7 SASI_Hs02_00518907 predicted 469
8 SASI_Hs02_00518908 predicted 1975
9 SASI_Hs02_00518909 predicted 1184
10 SASI_Hs02_00518910 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518911 predicted 2037
2 SASI_Hs02_00518912 predicted 356
3 SASI_Hs02_00518913 predicted 541
4 SASI_Hs02_00518914 predicted 1299
5 SASI_Hs02_00518915 predicted 577
6 SASI_Hs02_00518916 predicted 1460
7 SASI_Hs02_00518917 predicted 474
8 SASI_Hs02_00518918 predicted 1976
9 SASI_Hs02_00518919 predicted 1182
10 SASI_Hs02_00518920 predicted 575
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153375
TINCR MISSION shRNA Bacterial Glycerol Stock
tissue differentiation-inducing non-protein coding RNA
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153375.1-648s1c1
Sequence:CCGGGCCACCTTGGAAAGCTCCCATCTCGAGATGGGAGCTTTCCAAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153375.1-819s1c1
Sequence:CCGGCAGCTCCAATACACCTGGGATCTCGAGATCCCAGGTGTATTGGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122346    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153375.1-2039s1c1
Sequence:CCGGCCTGTGCATATTCAGGGACATCTCGAGATGTCCCTGAATATGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153375.1-2106s1c1
Sequence:CCGGCAGTTTCATTCCTTGGTCCTTCTCGAGAAGGACCAAGGAATGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142526    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153375.1-1158s1c1
Sequence:CCGGGTTCTGAAGAACTCTGGCCAACTCGAGTTGGCCAGAGTTCTTCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153375.1-575s1c1
Sequence:CCGGCTGCTGTGTGACTTTGAGGTTCTCGAGAACCTCAAAGTCACACAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153375.1-686s1c1
Sequence:CCGGCGCAAGAAGAGAAGCACAGAACTCGAGTTCTGTGCTTCTCTTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153375.1-858s1c1
Sequence:CCGGGTCTTCTCAGATTCCCTCCTTCTCGAGAAGGAGGGAATCTGAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153375
TINCR MISSION shRNA shRNA Plasmid DNA
tissue differentiation-inducing non-protein coding RNA
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153375.1-648s1c1
Sequence:CCGGGCCACCTTGGAAAGCTCCCATCTCGAGATGGGAGCTTTCCAAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153375.1-819s1c1
Sequence:CCGGCAGCTCCAATACACCTGGGATCTCGAGATCCCAGGTGTATTGGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122346    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153375.1-2039s1c1
Sequence:CCGGCCTGTGCATATTCAGGGACATCTCGAGATGTCCCTGAATATGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153375.1-2106s1c1
Sequence:CCGGCAGTTTCATTCCTTGGTCCTTCTCGAGAAGGACCAAGGAATGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142526    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153375.1-1158s1c1
Sequence:CCGGGTTCTGAAGAACTCTGGCCAACTCGAGTTGGCCAGAGTTCTTCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153375.1-575s1c1
Sequence:CCGGCTGCTGTGTGACTTTGAGGTTCTCGAGAACCTCAAAGTCACACAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153375.1-686s1c1
Sequence:CCGGCGCAAGAAGAGAAGCACAGAACTCGAGTTCTGTGCTTCTCTTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153375.1-858s1c1
Sequence:CCGGGTCTTCTCAGATTCCCTCCTTCTCGAGAAGGAGGGAATCTGAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153375
TINCR MISSION shRNA Lentiviral Transduction Particles
tissue differentiation-inducing non-protein coding RNA
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153375.1-648s1c1
Sequence:CCGGGCCACCTTGGAAAGCTCCCATCTCGAGATGGGAGCTTTCCAAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153375.1-819s1c1
Sequence:CCGGCAGCTCCAATACACCTGGGATCTCGAGATCCCAGGTGTATTGGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122346    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153375.1-2039s1c1
Sequence:CCGGCCTGTGCATATTCAGGGACATCTCGAGATGTCCCTGAATATGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153375.1-2106s1c1
Sequence:CCGGCAGTTTCATTCCTTGGTCCTTCTCGAGAAGGACCAAGGAATGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142526    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153375.1-1158s1c1
Sequence:CCGGGTTCTGAAGAACTCTGGCCAACTCGAGTTGGCCAGAGTTCTTCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153375.1-575s1c1
Sequence:CCGGCTGCTGTGTGACTTTGAGGTTCTCGAGAACCTCAAAGTCACACAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153375.1-686s1c1
Sequence:CCGGCGCAAGAAGAGAAGCACAGAACTCGAGTTCTGTGCTTCTCTTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153375.1-858s1c1
Sequence:CCGGGTCTTCTCAGATTCCCTCCTTCTCGAGAAGGAGGGAATCTGAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks