EMAIL THIS PAGE TO A FRIEND

TINF2

TERF1 (TRF1)-interacting nuclear factor 2

Synonyms: DKCA3 TIN2
UniProtKB ID: Q9BSI4, Q9H904, Q9UHC2
Gene ID:
Human(26277) Summary: This gene encodes one of the proteins of the shelterin, or telosome, complex which protects telomeres by allowing the cell to distinguish between telomeres and regions of DNA damage. The protein encoded by this gene is a critical part of shelterin; it interacts with the three DNA-binding proteins of the shelterin complex, and it is important for assembly of the complex. Mutations in this gene cause dyskeratosis congenita (DKC), an inherited bone marrow failure syndrome. [provided by RefSeq, Mar 2010]
Mouse(28113) Terf1 (TRF1)-interacting nuclear factor 2
Rat(290232) TERF1 (TRF1)-interacting nuclear factor 2
cow(540420) TERF1 (TRF1)-interacting nuclear factor 2
sheep(101114958) TERF1 (TRF1)-interacting nuclear factor 2
naked mole-rat(101723913) TERF1 (TRF1)-interacting nuclear factor 2
domestic guinea pig(100735848) TERF1 (TRF1)-interacting nuclear factor 2
Zebrafish(566362) TERF1 (TRF1)-interacting nuclear factor 2
domestic cat(101081811) TERF1 (TRF1)-interacting nuclear factor 2
Horse(100054625) TERF1 (TRF1)-interacting nuclear factor 2
dog(608377) TERF1 (TRF1)-interacting nuclear factor 2
144 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012461 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012461 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012461 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145705 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145705 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145705 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU025411 MISSION® esiRNA esiRNA targeting mouse Tinf2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099274 Rosetta Predictions human pricing
NM_012461 Rosetta Predictions human pricing
NM_001006962 Rosetta Predictions rat pricing
NM_145705 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320337 predicted 951
2 SASI_Hs02_00320338 predicted 1088
3 SASI_Hs02_00320339 predicted 1147
4 SASI_Hs02_00320340 predicted 1003
5 SASI_Hs02_00320341 predicted 985
6 SASI_Hs02_00320342 predicted 722
7 SASI_Hs02_00320343 predicted 739
8 SASI_Hs02_00320344 predicted 1090
9 SASI_Hs02_00320345 predicted 614
10 SASI_Hs02_00320346 predicted 1051
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010102 predicted 947
2 SASI_Hs02_00344370 predicted 1089
3 SASI_Hs02_00344371 predicted 1139
4 SASI_Hs01_00010103 predicted 1004
5 SASI_Hs01_00010105 predicted 985
6 SASI_Hs02_00344372 predicted 727
7 SASI_Hs01_00010108 predicted 732
8 SASI_Hs02_00344373 predicted 1093
9 SASI_Hs01_00010109 predicted 610
10 SASI_Hs01_00010110 predicted 1047
11 SASI_Hs01_00010101 predicted 1177
12 SASI_Hs01_00010104 predicted 1121
13 SASI_Hs01_00010106 predicted 1328
14 SASI_Hs01_00010107 predicted 1116
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006962 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039113 predicted 614
2 SASI_Rn01_00039114 predicted 1245
3 SASI_Rn01_00039115 predicted 1071
4 SASI_Rn01_00039116 predicted 929
5 SASI_Rn01_00039117 predicted 1357
6 SASI_Rn02_00198518 predicted 1098
7 SASI_Rn01_00039119 predicted 764
8 SASI_Rn01_00039120 predicted 726
9 SASI_Rn02_00198519 predicted 660
10 SASI_Rn01_00039121 predicted 483
11 SASI_Rn01_00039112 predicted 1296
12 SASI_Rn01_00039118 predicted 1299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145705 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106062 predicted 1180
2 SASI_Mm01_00106063 predicted 529
3 SASI_Mm01_00106064 predicted 964
4 SASI_Mm01_00106065 predicted 1409
5 SASI_Mm01_00106066 predicted 233
6 SASI_Mm01_00106067 predicted 734
7 SASI_Mm01_00106068 predicted 810
8 SASI_Mm01_00106069 predicted 871
9 SASI_Mm01_00106070 predicted 771
10 SASI_Mm01_00106071 predicted 997
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012461
VALIDATED
TINF2 MISSION shRNA Bacterial Glycerol Stock
TERF1 (TRF1)-interacting nuclear factor 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012461.1-1341s1c1
Sequence:CCGGGCTTCTTAATAGGAGCACATTCTCGAGAATGTGCTCCTATTAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012461.1-427s1c1
Sequence:CCGGACGCCTTTGTATGGGCCTAAACTCGAGTTTAGGCCCATACAAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012461.1-829s1c1
Sequence:CCGGGAGACAATATGGTGTGGACATCTCGAGATGTCCACACCATATTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012461.1-1176s1c1
Sequence:CCGGGCAAGGAAGAACATGCGATATCTCGAGATATCGCATGTTCTTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_012461.1-658s1c1
Sequence:CCGGGCAGGAACTTGAACAAGAGTACTCGAGTACTCTTGTTCAAGTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012461.x-829s1c1
Sequence:CCGGAGACAATATGGTGTGGACATCTCGAGATGTCCACACCATATTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012461.2-1257s21c1
Sequence:GTACCGGCAAGGAAGAACATGCGATATACTCGAGTATATCGCATGTTCTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012461.2-1625s21c1
Sequence:CCGGTCATCTAGAAGTAGTAGTTTGCTCGAGCAAACTACTACTTCTAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012461.2-1228s21c1
Sequence:CCGGCCAACCCAGGTCATATCTAAGCTCGAGCTTAGATATGACCTGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012461.2-899s21c1
Sequence:CCGGCTCTTGCCTGGAGACAATATGCTCGAGCATATTGTCTCCAGGCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012461.2-507s21c1
Sequence:CCGGACGCCTTTGTATGGGCCTAAACTCGAGTTTAGGCCCATACAAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012461
VALIDATED
TINF2 MISSION shRNA shRNA Plasmid DNA
TERF1 (TRF1)-interacting nuclear factor 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012461.1-1341s1c1
Sequence:CCGGGCTTCTTAATAGGAGCACATTCTCGAGAATGTGCTCCTATTAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012461.1-427s1c1
Sequence:CCGGACGCCTTTGTATGGGCCTAAACTCGAGTTTAGGCCCATACAAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012461.1-829s1c1
Sequence:CCGGGAGACAATATGGTGTGGACATCTCGAGATGTCCACACCATATTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012461.1-1176s1c1
Sequence:CCGGGCAAGGAAGAACATGCGATATCTCGAGATATCGCATGTTCTTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_012461.1-658s1c1
Sequence:CCGGGCAGGAACTTGAACAAGAGTACTCGAGTACTCTTGTTCAAGTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012461.x-829s1c1
Sequence:CCGGAGACAATATGGTGTGGACATCTCGAGATGTCCACACCATATTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012461.2-1257s21c1
Sequence:GTACCGGCAAGGAAGAACATGCGATATACTCGAGTATATCGCATGTTCTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012461.2-1625s21c1
Sequence:CCGGTCATCTAGAAGTAGTAGTTTGCTCGAGCAAACTACTACTTCTAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012461.2-1228s21c1
Sequence:CCGGCCAACCCAGGTCATATCTAAGCTCGAGCTTAGATATGACCTGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012461.2-899s21c1
Sequence:CCGGCTCTTGCCTGGAGACAATATGCTCGAGCATATTGTCTCCAGGCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012461.2-507s21c1
Sequence:CCGGACGCCTTTGTATGGGCCTAAACTCGAGTTTAGGCCCATACAAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012461
VALIDATED
TINF2 MISSION shRNA Lentiviral Transduction Particles
TERF1 (TRF1)-interacting nuclear factor 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012461.1-1341s1c1
Sequence:CCGGGCTTCTTAATAGGAGCACATTCTCGAGAATGTGCTCCTATTAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012461.1-427s1c1
Sequence:CCGGACGCCTTTGTATGGGCCTAAACTCGAGTTTAGGCCCATACAAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012461.1-829s1c1
Sequence:CCGGGAGACAATATGGTGTGGACATCTCGAGATGTCCACACCATATTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012461.1-1176s1c1
Sequence:CCGGGCAAGGAAGAACATGCGATATCTCGAGATATCGCATGTTCTTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_012461.1-658s1c1
Sequence:CCGGGCAGGAACTTGAACAAGAGTACTCGAGTACTCTTGTTCAAGTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012461.x-829s1c1
Sequence:CCGGAGACAATATGGTGTGGACATCTCGAGATGTCCACACCATATTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012461.2-1257s21c1
Sequence:GTACCGGCAAGGAAGAACATGCGATATACTCGAGTATATCGCATGTTCTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012461.2-1625s21c1
Sequence:CCGGTCATCTAGAAGTAGTAGTTTGCTCGAGCAAACTACTACTTCTAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012461.2-1228s21c1
Sequence:CCGGCCAACCCAGGTCATATCTAAGCTCGAGCTTAGATATGACCTGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012461.2-899s21c1
Sequence:CCGGCTCTTGCCTGGAGACAATATGCTCGAGCATATTGTCTCCAGGCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012461.2-507s21c1
Sequence:CCGGACGCCTTTGTATGGGCCTAAACTCGAGTTTAGGCCCATACAAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145705
VALIDATED
TINF2 MISSION shRNA Bacterial Glycerol Stock
TERF1 (TRF1)-interacting nuclear factor 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145705.2-1358s1c1
Sequence:CCGGAGACGAAGTTTGACACCTATACTCGAGTATAGGTGTCAAACTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145705.2-678s1c1
Sequence:CCGGCATCACTTCTTCGGTTGCTTTCTCGAGAAAGCAACCGAAGAAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145705.2-529s1c1
Sequence:CCGGCAGGAACTAGAACAAGACTATCTCGAGATAGTCTTGTTCTAGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145705.2-1499s1c1
Sequence:CCGGCTGCATGCAATTTAGTGGAAACTCGAGTTTCCACTAAATTGCATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145705.2-1004s1c1
Sequence:CCGGGCTTACCAGCTCAAGACTTATCTCGAGATAAGTCTTGAGCTGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145705.2-1004s21c1
Sequence:CCGGGCTTACCAGCTCAAGACTTATCTCGAGATAAGTCTTGAGCTGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145705.2-1418s21c1
Sequence:CCGGATTCCTTTCTGGCTACCTAAACTCGAGTTTAGGTAGCCAGAAAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145705.2-1257s21c1
Sequence:CCGGCCCGTGTAGCTCTGTTATTACCTCGAGGTAATAACAGAGCTACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145705.2-880s21c1
Sequence:CCGGTTAGCTGGCCACCGCTTTAATCTCGAGATTAAAGCGGTGGCCAGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145705.3-1566s21c1
Sequence:CCGGTGCAGCTCTGCATGCAATTTACTCGAGTAAATTGCATGCAGAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145705.2-529s21c1
Sequence:CCGGCAGGAACTAGAACAAGACTATCTCGAGATAGTCTTGTTCTAGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145705
VALIDATED
TINF2 MISSION shRNA shRNA Plasmid DNA
TERF1 (TRF1)-interacting nuclear factor 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145705.2-1358s1c1
Sequence:CCGGAGACGAAGTTTGACACCTATACTCGAGTATAGGTGTCAAACTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145705.2-678s1c1
Sequence:CCGGCATCACTTCTTCGGTTGCTTTCTCGAGAAAGCAACCGAAGAAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145705.2-529s1c1
Sequence:CCGGCAGGAACTAGAACAAGACTATCTCGAGATAGTCTTGTTCTAGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145705.2-1499s1c1
Sequence:CCGGCTGCATGCAATTTAGTGGAAACTCGAGTTTCCACTAAATTGCATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145705.2-1004s1c1
Sequence:CCGGGCTTACCAGCTCAAGACTTATCTCGAGATAAGTCTTGAGCTGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145705.2-1004s21c1
Sequence:CCGGGCTTACCAGCTCAAGACTTATCTCGAGATAAGTCTTGAGCTGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145705.2-1418s21c1
Sequence:CCGGATTCCTTTCTGGCTACCTAAACTCGAGTTTAGGTAGCCAGAAAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145705.2-1257s21c1
Sequence:CCGGCCCGTGTAGCTCTGTTATTACCTCGAGGTAATAACAGAGCTACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145705.2-880s21c1
Sequence:CCGGTTAGCTGGCCACCGCTTTAATCTCGAGATTAAAGCGGTGGCCAGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145705.3-1566s21c1
Sequence:CCGGTGCAGCTCTGCATGCAATTTACTCGAGTAAATTGCATGCAGAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145705.2-529s21c1
Sequence:CCGGCAGGAACTAGAACAAGACTATCTCGAGATAGTCTTGTTCTAGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145705
VALIDATED
TINF2 MISSION shRNA Lentiviral Transduction Particles
TERF1 (TRF1)-interacting nuclear factor 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145705.2-1358s1c1
Sequence:CCGGAGACGAAGTTTGACACCTATACTCGAGTATAGGTGTCAAACTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145705.2-678s1c1
Sequence:CCGGCATCACTTCTTCGGTTGCTTTCTCGAGAAAGCAACCGAAGAAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145705.2-529s1c1
Sequence:CCGGCAGGAACTAGAACAAGACTATCTCGAGATAGTCTTGTTCTAGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145705.2-1499s1c1
Sequence:CCGGCTGCATGCAATTTAGTGGAAACTCGAGTTTCCACTAAATTGCATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145705.2-1004s1c1
Sequence:CCGGGCTTACCAGCTCAAGACTTATCTCGAGATAAGTCTTGAGCTGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145705.2-1004s21c1
Sequence:CCGGGCTTACCAGCTCAAGACTTATCTCGAGATAAGTCTTGAGCTGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145705.2-1418s21c1
Sequence:CCGGATTCCTTTCTGGCTACCTAAACTCGAGTTTAGGTAGCCAGAAAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145705.2-1257s21c1
Sequence:CCGGCCCGTGTAGCTCTGTTATTACCTCGAGGTAATAACAGAGCTACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145705.2-880s21c1
Sequence:CCGGTTAGCTGGCCACCGCTTTAATCTCGAGATTAAAGCGGTGGCCAGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145705.3-1566s21c1
Sequence:CCGGTGCAGCTCTGCATGCAATTTACTCGAGTAAATTGCATGCAGAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145705.2-529s21c1
Sequence:CCGGCAGGAACTAGAACAAGACTATCTCGAGATAGTCTTGTTCTAGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks