EMAIL THIS PAGE TO A FRIEND

TIPARP

TCDD-inducible poly(ADP-ribose) polymerase

Synonyms: ARTD14 PARP7 pART14
UniProtKB ID: Q7Z3E1, D3DNK6, Q68CY9, Q86VP4, Q9Y4P7
Gene ID:
Human(25976) Summary: This gene encodes a member of the poly(ADP-ribose) polymerase superfamily. Studies of the mouse ortholog have shown that the encoded protein catalyzes histone poly(ADP-ribosyl)ation and may be involved in T-cell function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Mouse(99929) TCDD-inducible poly(ADP-ribose) polymerase
Rat(310467) TCDD-inducible poly(ADP-ribose) polymerase
Zebrafish(563506) TCDD-inducible poly(ADP-ribose) polymerase
dog(485728) TCDD-inducible poly(ADP-ribose) polymerase
chicken(425026) TCDD-inducible poly(ADP-ribose) polymerase
domestic cat(101085655) TCDD-inducible poly(ADP-ribose) polymerase
Horse(100050358) TCDD-inducible poly(ADP-ribose) polymerase
domestic guinea pig(100726322) TCDD-inducible poly(ADP-ribose) polymerase
naked mole-rat(101721870) TCDD-inducible poly(ADP-ribose) polymerase
cow(540975) TCDD-inducible poly(ADP-ribose) polymerase
sheep(101110289) TCDD-inducible poly(ADP-ribose) polymerase
150 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015508 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015508 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015508 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178892 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178892 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178892 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015508 Rosetta Predictions human pricing
NM_001107679 Rosetta Predictions rat pricing
NM_178892 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015508 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202925 predicted 1589
2 SASI_Hs01_00202926 predicted 1150
3 SASI_Hs01_00202927 predicted 1316
4 SASI_Hs02_00347990 predicted 2098
5 SASI_Hs02_00347991 predicted 1949
6 SASI_Hs02_00347992 predicted 1898
7 SASI_Hs01_00202928 predicted 474
8 SASI_Hs01_00202929 predicted 1402
9 SASI_Hs01_00202930 predicted 1260
10 SASI_Hs01_00202931 predicted 1032
11 SASI_Hs01_00202924 predicted 1201
12 SASI_Hs01_00202932 predicted 966
13 SASI_Hs01_00202933 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107679 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231205 predicted 1967
2 SASI_Rn02_00231206 predicted 2119
3 SASI_Rn02_00231207 predicted 1914
4 SASI_Rn02_00231208 predicted 1842
5 SASI_Rn02_00231209 predicted 1995
6 SASI_Rn02_00231210 predicted 2611
7 SASI_Rn02_00231211 predicted 1825
8 SASI_Rn02_00231212 predicted 2710
9 SASI_Rn02_00231213 predicted 2021
10 SASI_Rn02_00231214 predicted 1899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178892 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095331 predicted 1517
2 SASI_Mm01_00095332 predicted 1240
3 SASI_Mm01_00095334 predicted 1140
4 SASI_Mm01_00095335 predicted 1234
5 SASI_Mm01_00095336 predicted 1830
6 SASI_Mm01_00095338 predicted 1566
7 SASI_Mm02_00349491 predicted 563
8 SASI_Mm01_00095339 predicted 1840
9 SASI_Mm02_00349492 predicted 2210
10 SASI_Mm01_00095340 predicted 837
11 SASI_Mm01_00095333 predicted 827
12 SASI_Mm01_00095337 predicted 2216
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015508
VALIDATED
TIPARP MISSION shRNA Bacterial Glycerol Stock
TCDD-inducible poly(ADP-ribose) polymerase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015508.3-408s21c1
Sequence:CCGGAGGTCTTTGAGGCCAATATTACTCGAGTAATATTGGCCTCAAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015508.3-1256s21c1
Sequence:CCGGTAGCAATGTCAACTCTATTTACTCGAGTAAATAGAGTTGACATTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015508.3-1949s21c1
Sequence:CCGGGAAGGCAAGCTACTCTCATAACTCGAGTTATGAGAGTAGCTTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273097    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_015508.3-2596s21c1
Sequence:CCGGGAGCAATGTGAGGATTCTATTCTCGAGAATAGAATCCTCACATTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015508.3-1922s21c1
Sequence:CCGGGTTTGGACAAGGCAGTTATTTCTCGAGAAATAACTGCCTTGTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015508.x-1930s1c1
Sequence:CCGGGAAGGCAAGCTACTCTCATAACTCGAGTTATGAGAGTAGCTTGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015508.x-1463s1c1
Sequence:CCGGCTTCCATATTTACAGACACTTCTCGAGAAGTGTCTGTAAATATGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015508.x-457s1c1
Sequence:CCGGGAACCAGAGTACAGATGAGAACTCGAGTTCTCATCTGTACTCTGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004466    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015508.x-3228s1c1
Sequence:CCGGCCTTACTTACACTACTTACTTCTCGAGAAGTAAGTAGTGTAAGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015508.x-978s1c1
Sequence:CCGGCTTGTATTTATGGCAGGGATTCTCGAGAATCCCTGCCATAAATACAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015508
VALIDATED
TIPARP MISSION shRNA shRNA Plasmid DNA
TCDD-inducible poly(ADP-ribose) polymerase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015508.3-408s21c1
Sequence:CCGGAGGTCTTTGAGGCCAATATTACTCGAGTAATATTGGCCTCAAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015508.3-1256s21c1
Sequence:CCGGTAGCAATGTCAACTCTATTTACTCGAGTAAATAGAGTTGACATTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015508.3-1949s21c1
Sequence:CCGGGAAGGCAAGCTACTCTCATAACTCGAGTTATGAGAGTAGCTTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273097    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_015508.3-2596s21c1
Sequence:CCGGGAGCAATGTGAGGATTCTATTCTCGAGAATAGAATCCTCACATTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015508.3-1922s21c1
Sequence:CCGGGTTTGGACAAGGCAGTTATTTCTCGAGAAATAACTGCCTTGTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015508.x-1930s1c1
Sequence:CCGGGAAGGCAAGCTACTCTCATAACTCGAGTTATGAGAGTAGCTTGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015508.x-1463s1c1
Sequence:CCGGCTTCCATATTTACAGACACTTCTCGAGAAGTGTCTGTAAATATGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015508.x-457s1c1
Sequence:CCGGGAACCAGAGTACAGATGAGAACTCGAGTTCTCATCTGTACTCTGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004466    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015508.x-3228s1c1
Sequence:CCGGCCTTACTTACACTACTTACTTCTCGAGAAGTAAGTAGTGTAAGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015508.x-978s1c1
Sequence:CCGGCTTGTATTTATGGCAGGGATTCTCGAGAATCCCTGCCATAAATACAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015508
VALIDATED
TIPARP MISSION shRNA Lentiviral Transduction Particles
TCDD-inducible poly(ADP-ribose) polymerase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015508.3-408s21c1
Sequence:CCGGAGGTCTTTGAGGCCAATATTACTCGAGTAATATTGGCCTCAAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015508.3-1256s21c1
Sequence:CCGGTAGCAATGTCAACTCTATTTACTCGAGTAAATAGAGTTGACATTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015508.3-1949s21c1
Sequence:CCGGGAAGGCAAGCTACTCTCATAACTCGAGTTATGAGAGTAGCTTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273097    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_015508.3-2596s21c1
Sequence:CCGGGAGCAATGTGAGGATTCTATTCTCGAGAATAGAATCCTCACATTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015508.3-1922s21c1
Sequence:CCGGGTTTGGACAAGGCAGTTATTTCTCGAGAAATAACTGCCTTGTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015508.x-1930s1c1
Sequence:CCGGGAAGGCAAGCTACTCTCATAACTCGAGTTATGAGAGTAGCTTGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015508.x-1463s1c1
Sequence:CCGGCTTCCATATTTACAGACACTTCTCGAGAAGTGTCTGTAAATATGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015508.x-457s1c1
Sequence:CCGGGAACCAGAGTACAGATGAGAACTCGAGTTCTCATCTGTACTCTGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004466    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015508.x-3228s1c1
Sequence:CCGGCCTTACTTACACTACTTACTTCTCGAGAAGTAAGTAGTGTAAGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015508.x-978s1c1
Sequence:CCGGCTTGTATTTATGGCAGGGATTCTCGAGAATCCCTGCCATAAATACAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178892
VALIDATED
TIPARP MISSION shRNA Bacterial Glycerol Stock
TCDD-inducible poly(ADP-ribose) polymerase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178892.5-1226s21c1
Sequence:CCGGTACACCACCCTGTAGTAATTCCTCGAGGAATTACTACAGGGTGGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178892.5-1013s21c1
Sequence:CCGGCACCGTATTGCCCTATCATTGCTCGAGCAATGATAGGGCAATACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178892.5-2698s1c1
Sequence:CCGGATACGTTCATGTAAGTCTAATCTCGAGATTAGACTTACATGAACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_178892.5-2138s1c1
Sequence:CCGGTGACCAGAGTTACCCTTATTTCTCGAGAAATAAGGGTAACTCTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178892.5-1901s1c1
Sequence:CCGGGTTTGGACAAGGCAGTTATTTCTCGAGAAATAACTGCCTTGTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_178892.5-1375s1c1
Sequence:CCGGTGATGTGGAACAACCATTATACTCGAGTATAATGGTTGTTCCACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178892.5-390s1c1
Sequence:CCGGAGATCCTTGAGGCCAATATTACTCGAGTAATATTGGCCTCAAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178892.5-2639s21c1
Sequence:CCGGACTGATACTATCGTGCTTATTCTCGAGAATAAGCACGATAGTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178892.5-750s21c1
Sequence:CCGGAGTCCTGACTGCGTAGATAAACTCGAGTTTATCTACGCAGTCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178892.5-1313s21c1
Sequence:CCGGTGAGTCTGTTGTTCGACTAATCTCGAGATTAGTCGAACAACAGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178892
VALIDATED
TIPARP MISSION shRNA shRNA Plasmid DNA
TCDD-inducible poly(ADP-ribose) polymerase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178892.5-1226s21c1
Sequence:CCGGTACACCACCCTGTAGTAATTCCTCGAGGAATTACTACAGGGTGGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178892.5-1013s21c1
Sequence:CCGGCACCGTATTGCCCTATCATTGCTCGAGCAATGATAGGGCAATACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178892.5-2698s1c1
Sequence:CCGGATACGTTCATGTAAGTCTAATCTCGAGATTAGACTTACATGAACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_178892.5-2138s1c1
Sequence:CCGGTGACCAGAGTTACCCTTATTTCTCGAGAAATAAGGGTAACTCTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178892.5-1901s1c1
Sequence:CCGGGTTTGGACAAGGCAGTTATTTCTCGAGAAATAACTGCCTTGTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_178892.5-1375s1c1
Sequence:CCGGTGATGTGGAACAACCATTATACTCGAGTATAATGGTTGTTCCACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178892.5-390s1c1
Sequence:CCGGAGATCCTTGAGGCCAATATTACTCGAGTAATATTGGCCTCAAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178892.5-2639s21c1
Sequence:CCGGACTGATACTATCGTGCTTATTCTCGAGAATAAGCACGATAGTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178892.5-750s21c1
Sequence:CCGGAGTCCTGACTGCGTAGATAAACTCGAGTTTATCTACGCAGTCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178892.5-1313s21c1
Sequence:CCGGTGAGTCTGTTGTTCGACTAATCTCGAGATTAGTCGAACAACAGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178892
VALIDATED
TIPARP MISSION shRNA Lentiviral Transduction Particles
TCDD-inducible poly(ADP-ribose) polymerase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178892.5-1226s21c1
Sequence:CCGGTACACCACCCTGTAGTAATTCCTCGAGGAATTACTACAGGGTGGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178892.5-1013s21c1
Sequence:CCGGCACCGTATTGCCCTATCATTGCTCGAGCAATGATAGGGCAATACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178892.5-2698s1c1
Sequence:CCGGATACGTTCATGTAAGTCTAATCTCGAGATTAGACTTACATGAACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_178892.5-2138s1c1
Sequence:CCGGTGACCAGAGTTACCCTTATTTCTCGAGAAATAAGGGTAACTCTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178892.5-1901s1c1
Sequence:CCGGGTTTGGACAAGGCAGTTATTTCTCGAGAAATAACTGCCTTGTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_178892.5-1375s1c1
Sequence:CCGGTGATGTGGAACAACCATTATACTCGAGTATAATGGTTGTTCCACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178892.5-390s1c1
Sequence:CCGGAGATCCTTGAGGCCAATATTACTCGAGTAATATTGGCCTCAAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178892.5-2639s21c1
Sequence:CCGGACTGATACTATCGTGCTTATTCTCGAGAATAAGCACGATAGTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178892.5-750s21c1
Sequence:CCGGAGTCCTGACTGCGTAGATAAACTCGAGTTTATCTACGCAGTCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178892.5-1313s21c1
Sequence:CCGGTGAGTCTGTTGTTCGACTAATCTCGAGATTAGTCGAACAACAGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks