EMAIL THIS PAGE TO A FRIEND

TIPIN

TIMELESS interacting protein

UniProtKB ID: Q9BVW5, B2CW64, Q9NWZ6
Gene ID:
Mouse(66131) timeless interacting protein
Rat(363076) timeless interacting protein
Zebrafish(445058) timeless interacting protein
chicken(415548) TIMELESS interacting protein
dog(100683743) TIMELESS interacting protein
domestic cat(101095262) TIMELESS interacting protein
cow(506176) TIMELESS interacting protein
sheep(101123380) TIMELESS interacting protein
naked mole-rat(101716762) TIMELESS interacting protein
domestic guinea pig(100719663) TIMELESS interacting protein
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025372 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025372 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025372 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017858 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017858 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017858 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017858 Rosetta Predictions human pricing
NM_001025287 Rosetta Predictions rat pricing
NM_025372 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134669 predicted 853
2 SASI_Hs01_00134670 predicted 327
3 SASI_Hs01_00134671 predicted 881
4 SASI_Hs01_00134673 predicted 867
5 SASI_Hs02_00350773 predicted 981
6 SASI_Hs01_00134674 predicted 628
7 SASI_Hs01_00134675 predicted 323
8 SASI_Hs01_00134676 predicted 366
9 SASI_Hs01_00134678 predicted 651
10 SASI_Hs02_00350774 predicted 593
11 SASI_Hs01_00134672 predicted 529
12 SASI_Hs01_00134677 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025287 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107775 predicted 264
2 SASI_Rn01_00107776 predicted 671
3 SASI_Rn01_00107777 predicted 541
4 SASI_Rn01_00107778 predicted 199
5 SASI_Rn01_00107779 predicted 534
6 SASI_Rn01_00107780 predicted 731
7 SASI_Rn01_00107781 predicted 714
8 SASI_Rn01_00107782 predicted 853
9 SASI_Rn01_00107783 predicted 795
10 SASI_Rn01_00107784 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025372 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069652 predicted 849
2 SASI_Mm01_00069653 predicted 595
3 SASI_Mm01_00069654 predicted 969
4 SASI_Mm01_00069655 predicted 883
5 SASI_Mm01_00069656 predicted 556
6 SASI_Mm01_00069657 predicted 766
7 SASI_Mm01_00069658 predicted 224
8 SASI_Mm01_00069659 predicted 245
9 SASI_Mm01_00069660 predicted 798
10 SASI_Mm02_00328091 predicted 857
11 SASI_Mm01_00069661 predicted 247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025372
VALIDATED
TIPIN MISSION shRNA Bacterial Glycerol Stock
TIMELESS interacting protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025372.1-207s1c1
Sequence:CCGGCCGCCAAAGAGAACAGTTAAACTCGAGTTTAACTGTTCTCTTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025372.1-990s1c1
Sequence:CCGGCTTATGTGGATTCCTGCTTAACTCGAGTTAAGCAGGAATCCACATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025372.1-822s1c1
Sequence:CCGGGCCAGTACACATGAAGAGGAACTCGAGTTCCTCTTCATGTGTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025372.1-238s1c1
Sequence:CCGGCTAAGCTAGATGCTACGAGATCTCGAGATCTCGTAGCATCTAGCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025372.1-688s1c1
Sequence:CCGGAGGCAAAGCTACTGAGTAATACTCGAGTATTACTCAGTAGCTTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025372.3-206s21c1
Sequence:CCGGCCGCCAAAGAGAACAGTTAAACTCGAGTTTAACTGTTCTCTTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025372.3-237s21c1
Sequence:CCGGCTAAGCTAGATGCTACGAGATCTCGAGATCTCGTAGCATCTAGCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025372.3-821s21c1
Sequence:CCGGGCCAGTACACATGAAGAGGAACTCGAGTTCCTCTTCATGTGTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025372.3-989s21c1
Sequence:CCGGCTTATGTGGATTCCTGCTTAACTCGAGTTAAGCAGGAATCCACATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025372.3-687s21c1
Sequence:CCGGAGGCAAAGCTACTGAGTAATACTCGAGTATTACTCAGTAGCTTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025372
VALIDATED
TIPIN MISSION shRNA shRNA Plasmid DNA
TIMELESS interacting protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025372.1-207s1c1
Sequence:CCGGCCGCCAAAGAGAACAGTTAAACTCGAGTTTAACTGTTCTCTTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025372.1-990s1c1
Sequence:CCGGCTTATGTGGATTCCTGCTTAACTCGAGTTAAGCAGGAATCCACATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025372.1-822s1c1
Sequence:CCGGGCCAGTACACATGAAGAGGAACTCGAGTTCCTCTTCATGTGTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025372.1-238s1c1
Sequence:CCGGCTAAGCTAGATGCTACGAGATCTCGAGATCTCGTAGCATCTAGCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025372.1-688s1c1
Sequence:CCGGAGGCAAAGCTACTGAGTAATACTCGAGTATTACTCAGTAGCTTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025372.3-206s21c1
Sequence:CCGGCCGCCAAAGAGAACAGTTAAACTCGAGTTTAACTGTTCTCTTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025372.3-237s21c1
Sequence:CCGGCTAAGCTAGATGCTACGAGATCTCGAGATCTCGTAGCATCTAGCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025372.3-821s21c1
Sequence:CCGGGCCAGTACACATGAAGAGGAACTCGAGTTCCTCTTCATGTGTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025372.3-989s21c1
Sequence:CCGGCTTATGTGGATTCCTGCTTAACTCGAGTTAAGCAGGAATCCACATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025372.3-687s21c1
Sequence:CCGGAGGCAAAGCTACTGAGTAATACTCGAGTATTACTCAGTAGCTTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025372
VALIDATED
TIPIN MISSION shRNA Lentiviral Transduction Particles
TIMELESS interacting protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025372.1-207s1c1
Sequence:CCGGCCGCCAAAGAGAACAGTTAAACTCGAGTTTAACTGTTCTCTTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025372.1-990s1c1
Sequence:CCGGCTTATGTGGATTCCTGCTTAACTCGAGTTAAGCAGGAATCCACATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025372.1-822s1c1
Sequence:CCGGGCCAGTACACATGAAGAGGAACTCGAGTTCCTCTTCATGTGTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025372.1-238s1c1
Sequence:CCGGCTAAGCTAGATGCTACGAGATCTCGAGATCTCGTAGCATCTAGCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025372.1-688s1c1
Sequence:CCGGAGGCAAAGCTACTGAGTAATACTCGAGTATTACTCAGTAGCTTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025372.3-206s21c1
Sequence:CCGGCCGCCAAAGAGAACAGTTAAACTCGAGTTTAACTGTTCTCTTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025372.3-237s21c1
Sequence:CCGGCTAAGCTAGATGCTACGAGATCTCGAGATCTCGTAGCATCTAGCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025372.3-821s21c1
Sequence:CCGGGCCAGTACACATGAAGAGGAACTCGAGTTCCTCTTCATGTGTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025372.3-989s21c1
Sequence:CCGGCTTATGTGGATTCCTGCTTAACTCGAGTTAAGCAGGAATCCACATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025372.3-687s21c1
Sequence:CCGGAGGCAAAGCTACTGAGTAATACTCGAGTATTACTCAGTAGCTTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017858
VALIDATED
TIPIN MISSION shRNA Bacterial Glycerol Stock
TIMELESS interacting protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017858.1-401s1c1
Sequence:CCGGGAGTTGAATACCTGGGAAGTACTCGAGTACTTCCCAGGTATTCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017858.1-622s1c1
Sequence:CCGGCAACGAAGAATTGAGAGAAATCTCGAGATTTCTCTCAATTCTTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017858.1-508s1c1
Sequence:CCGGGCGGAGAATAATGAACATGATCTCGAGATCATGTTCATTATTCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017858.1-547s1c1
Sequence:CCGGGATCCCTTTCTGACAAACTTACTCGAGTAAGTTTGTCAGAAAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017858.1-678s1c1
Sequence:CCGGGCTGAGTAATAGTCAGACCCTCTCGAGAGGGTCTGACTATTACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017858.2-609s21c1
Sequence:CCGGGATCCCTTTCTGACAAACTTACTCGAGTAAGTTTGTCAGAAAGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017858.2-570s21c1
Sequence:CCGGGCGGAGAATAATGAACATGATCTCGAGATCATGTTCATTATTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017858.2-463s21c1
Sequence:CCGGGAGTTGAATACCTGGGAAGTACTCGAGTACTTCCCAGGTATTCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017858.2-740s21c1
Sequence:CCGGGCTGAGTAATAGTCAGACCCTCTCGAGAGGGTCTGACTATTACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017858
VALIDATED
TIPIN MISSION shRNA shRNA Plasmid DNA
TIMELESS interacting protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017858.1-401s1c1
Sequence:CCGGGAGTTGAATACCTGGGAAGTACTCGAGTACTTCCCAGGTATTCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017858.1-622s1c1
Sequence:CCGGCAACGAAGAATTGAGAGAAATCTCGAGATTTCTCTCAATTCTTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017858.1-508s1c1
Sequence:CCGGGCGGAGAATAATGAACATGATCTCGAGATCATGTTCATTATTCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017858.1-547s1c1
Sequence:CCGGGATCCCTTTCTGACAAACTTACTCGAGTAAGTTTGTCAGAAAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017858.1-678s1c1
Sequence:CCGGGCTGAGTAATAGTCAGACCCTCTCGAGAGGGTCTGACTATTACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017858.2-609s21c1
Sequence:CCGGGATCCCTTTCTGACAAACTTACTCGAGTAAGTTTGTCAGAAAGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017858.2-570s21c1
Sequence:CCGGGCGGAGAATAATGAACATGATCTCGAGATCATGTTCATTATTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017858.2-463s21c1
Sequence:CCGGGAGTTGAATACCTGGGAAGTACTCGAGTACTTCCCAGGTATTCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017858.2-740s21c1
Sequence:CCGGGCTGAGTAATAGTCAGACCCTCTCGAGAGGGTCTGACTATTACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017858
VALIDATED
TIPIN MISSION shRNA Lentiviral Transduction Particles
TIMELESS interacting protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017858.1-401s1c1
Sequence:CCGGGAGTTGAATACCTGGGAAGTACTCGAGTACTTCCCAGGTATTCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017858.1-622s1c1
Sequence:CCGGCAACGAAGAATTGAGAGAAATCTCGAGATTTCTCTCAATTCTTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017858.1-508s1c1
Sequence:CCGGGCGGAGAATAATGAACATGATCTCGAGATCATGTTCATTATTCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017858.1-547s1c1
Sequence:CCGGGATCCCTTTCTGACAAACTTACTCGAGTAAGTTTGTCAGAAAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017858.1-678s1c1
Sequence:CCGGGCTGAGTAATAGTCAGACCCTCTCGAGAGGGTCTGACTATTACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017858.2-609s21c1
Sequence:CCGGGATCCCTTTCTGACAAACTTACTCGAGTAAGTTTGTCAGAAAGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017858.2-570s21c1
Sequence:CCGGGCGGAGAATAATGAACATGATCTCGAGATCATGTTCATTATTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017858.2-463s21c1
Sequence:CCGGGAGTTGAATACCTGGGAAGTACTCGAGTACTTCCCAGGTATTCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017858.2-740s21c1
Sequence:CCGGGCTGAGTAATAGTCAGACCCTCTCGAGAGGGTCTGACTATTACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks