EMAIL THIS PAGE TO A FRIEND

TIPRL

TIP41, TOR signaling pathway regulator-like (S. cerevisiae)

Synonyms: TIP TIP41 dJ69E11.3
UniProtKB ID: O75663, B2R8V3, Q5HYB2, Q8IZ86
Gene ID:
Human(261726) Summary: TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A) (see PPP2CA; MIM 176915), PP4 (see PPP4C; MIM 602035), and PP6 (see PPP6C; MIM 612725) (McConnell et al., 2007 [PubMed 17384681]
Mouse(226591) TIP41, TOR signalling pathway regulator-like (S. cerevisiae)
Rat(360869) TIP41, TOR signaling pathway regulator-like (S. cerevisiae)
domestic guinea pig(100714476) TIP41, TOR signaling pathway regulator-like (S. cerevisiae)
naked mole-rat(101699434) TIP41, TOR signaling pathway regulator-like (S. cerevisiae)
cow(540486) TIP41, TOR signaling pathway regulator-like (S. cerevisiae)
sheep(101117714) TIP41, TOR signaling pathway regulator-like (S. cerevisiae)
Zebrafish(393636) TIP41, TOR signaling pathway regulator-like (S. cerevisiae)
chicken(418374) TIP41, TOR signaling pathway regulator-like (S. cerevisiae)
dog(480084) TIP41, TOR signaling pathway regulator-like (S. cerevisiae)
domestic cat(101081109) TIP41, TOR signaling pathway regulator-like (S. cerevisiae)
148 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152902 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152902 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152902 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145513 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145513 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145513 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031800 Rosetta Predictions human pricing
NM_152902 Rosetta Predictions human pricing
NM_001109667 Rosetta Predictions rat pricing
NM_145513 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024817 predicted 354
2 SASI_Hs01_00024818 predicted 437
3 SASI_Hs01_00024819 predicted 368
4 SASI_Hs02_00307813 predicted 205
5 SASI_Hs01_00024820 predicted 393
6 SASI_Hs01_00024821 predicted 345
7 SASI_Hs01_00024822 predicted 354
8 SASI_Hs01_00024823 predicted 319
9 SASI_Hs01_00024824 predicted 333
10 SASI_Hs01_00024825 predicted 201
11 SASI_Hs01_00024826 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124337 predicted 347
2 SASI_Hs01_00124338 predicted 436
3 SASI_Hs01_00124339 predicted 366
4 SASI_Hs02_00366870 predicted 204
5 SASI_Hs01_00124340 predicted 396
6 SASI_Hs01_00124341 predicted 344
7 SASI_Hs01_00124342 predicted 351
8 SASI_Hs01_00124343 predicted 319
9 SASI_Hs01_00124344 predicted 334
10 SASI_Hs01_00124345 predicted 201
11 SASI_Hs01_00124346 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109667 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250532 predicted 338
2 SASI_Rn02_00250533 predicted 441
3 SASI_Rn02_00250534 predicted 746
4 SASI_Rn02_00250535 predicted 362
5 SASI_Rn02_00250536 predicted 231
6 SASI_Rn02_00250537 predicted 652
7 SASI_Rn02_00250538 predicted 354
8 SASI_Rn02_00250539 predicted 667
9 SASI_Rn02_00250540 predicted 636
10 SASI_Rn02_00250541 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145513 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340972 predicted 405
2 SASI_Mm02_00340973 predicted 859
3 SASI_Mm02_00340974 predicted 808
4 SASI_Mm02_00340975 predicted 715
5 SASI_Mm02_00340976 predicted 424
6 SASI_Mm02_00340977 predicted 840
7 SASI_Mm02_00340978 predicted 565
8 SASI_Mm02_00340979 predicted 412
9 SASI_Mm02_00340980 predicted 729
10 SASI_Mm02_00340981 predicted 439
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152902
VALIDATED
TIPRL MISSION shRNA Bacterial Glycerol Stock
TIP41, TOR signaling pathway regulator-like (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152902.3-1051s21c1
Sequence:CCGGGCCTTGTTTATGTACAGATTTCTCGAGAAATCTGTACATAAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152902.3-779s21c1
Sequence:CCGGCGAGAATATACGTCACGAGAACTCGAGTTCTCGTGACGTATATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_152902.3-242s21c1
Sequence:CCGGGTGGAGAAATTAGCCGATGAACTCGAGTTCATCGGCTAATTTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_152902.3-848s21c1
Sequence:CCGGCCTAATGAAATATCCCAGTATCTCGAGATACTGGGATATTTCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152902.2-1022s1c1
Sequence:CCGGGCCTTGTTTATGTACAGATTTCTCGAGAAATCTGTACATAAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_152902.2-818s1c1
Sequence:CCGGACCTAATGAAATATCCCAGTACTCGAGTACTGGGATATTTCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152902.2-213s1c1
Sequence:CCGGGTGGAGAAATTAGCCGATGAACTCGAGTTCATCGGCTAATTTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152902.2-750s1c1
Sequence:CCGGCGAGAATATACGTCACGAGAACTCGAGTTCTCGTGACGTATATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152902.2-819s1c1
Sequence:CCGGCCTAATGAAATATCCCAGTATCTCGAGATACTGGGATATTTCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152902
VALIDATED
TIPRL MISSION shRNA shRNA Plasmid DNA
TIP41, TOR signaling pathway regulator-like (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152902.3-1051s21c1
Sequence:CCGGGCCTTGTTTATGTACAGATTTCTCGAGAAATCTGTACATAAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152902.3-779s21c1
Sequence:CCGGCGAGAATATACGTCACGAGAACTCGAGTTCTCGTGACGTATATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_152902.3-242s21c1
Sequence:CCGGGTGGAGAAATTAGCCGATGAACTCGAGTTCATCGGCTAATTTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_152902.3-848s21c1
Sequence:CCGGCCTAATGAAATATCCCAGTATCTCGAGATACTGGGATATTTCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152902.2-1022s1c1
Sequence:CCGGGCCTTGTTTATGTACAGATTTCTCGAGAAATCTGTACATAAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_152902.2-818s1c1
Sequence:CCGGACCTAATGAAATATCCCAGTACTCGAGTACTGGGATATTTCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152902.2-213s1c1
Sequence:CCGGGTGGAGAAATTAGCCGATGAACTCGAGTTCATCGGCTAATTTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152902.2-750s1c1
Sequence:CCGGCGAGAATATACGTCACGAGAACTCGAGTTCTCGTGACGTATATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152902.2-819s1c1
Sequence:CCGGCCTAATGAAATATCCCAGTATCTCGAGATACTGGGATATTTCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152902
VALIDATED
TIPRL MISSION shRNA Lentiviral Transduction Particles
TIP41, TOR signaling pathway regulator-like (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152902.3-1051s21c1
Sequence:CCGGGCCTTGTTTATGTACAGATTTCTCGAGAAATCTGTACATAAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152902.3-779s21c1
Sequence:CCGGCGAGAATATACGTCACGAGAACTCGAGTTCTCGTGACGTATATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_152902.3-242s21c1
Sequence:CCGGGTGGAGAAATTAGCCGATGAACTCGAGTTCATCGGCTAATTTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_152902.3-848s21c1
Sequence:CCGGCCTAATGAAATATCCCAGTATCTCGAGATACTGGGATATTTCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152902.2-1022s1c1
Sequence:CCGGGCCTTGTTTATGTACAGATTTCTCGAGAAATCTGTACATAAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_152902.2-818s1c1
Sequence:CCGGACCTAATGAAATATCCCAGTACTCGAGTACTGGGATATTTCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152902.2-213s1c1
Sequence:CCGGGTGGAGAAATTAGCCGATGAACTCGAGTTCATCGGCTAATTTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152902.2-750s1c1
Sequence:CCGGCGAGAATATACGTCACGAGAACTCGAGTTCTCGTGACGTATATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152902.2-819s1c1
Sequence:CCGGCCTAATGAAATATCCCAGTATCTCGAGATACTGGGATATTTCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145513
VALIDATED
TIPRL MISSION shRNA Bacterial Glycerol Stock
TIP41, TOR signaling pathway regulator-like (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145513.3-852s21c1
Sequence:CCGGGTTTGTGAGAAGCTCGTATTTCTCGAGAAATACGAGCTTCTCACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145513.3-498s21c1
Sequence:CCGGGTACCTACAACAGATCATATACTCGAGTATATGATCTGTTGTAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145513.3-2235s21c1
Sequence:CCGGGAGTGAAATACAGGGTAATTTCTCGAGAAATTACCCTGTATTTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145513.3-440s1c1
Sequence:CCGGGACCTATACAACAGATTATAACTCGAGTTATAATCTGTTGTATAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145513.3-440s21c1
Sequence:CCGGGACCTATACAACAGATTATAACTCGAGTTATAATCTGTTGTATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145513.3-731s21c1
Sequence:CCGGGACCTACATGTTACGAGAATACTCGAGTATTCTCGTAACATGTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145513.2-850s1c1
Sequence:CCGGGCAGTTTGTGAGAAGCTCGTACTCGAGTACGAGCTTCTCACAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201204    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145513.2-2671s1c1
Sequence:CCGGGCCAACATCTTACTTCAAGATCTCGAGATCTTGAAGTAAGATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201445    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145513.2-1902s1c1
Sequence:CCGGCCCTAGTTTGTTCGCCTTTAACTCGAGTTAAAGGCGAACAAACTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145513
VALIDATED
TIPRL MISSION shRNA shRNA Plasmid DNA
TIP41, TOR signaling pathway regulator-like (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145513.3-852s21c1
Sequence:CCGGGTTTGTGAGAAGCTCGTATTTCTCGAGAAATACGAGCTTCTCACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145513.3-498s21c1
Sequence:CCGGGTACCTACAACAGATCATATACTCGAGTATATGATCTGTTGTAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145513.3-2235s21c1
Sequence:CCGGGAGTGAAATACAGGGTAATTTCTCGAGAAATTACCCTGTATTTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145513.3-440s1c1
Sequence:CCGGGACCTATACAACAGATTATAACTCGAGTTATAATCTGTTGTATAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145513.3-440s21c1
Sequence:CCGGGACCTATACAACAGATTATAACTCGAGTTATAATCTGTTGTATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145513.3-731s21c1
Sequence:CCGGGACCTACATGTTACGAGAATACTCGAGTATTCTCGTAACATGTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145513.2-850s1c1
Sequence:CCGGGCAGTTTGTGAGAAGCTCGTACTCGAGTACGAGCTTCTCACAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201204    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145513.2-2671s1c1
Sequence:CCGGGCCAACATCTTACTTCAAGATCTCGAGATCTTGAAGTAAGATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201445    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145513.2-1902s1c1
Sequence:CCGGCCCTAGTTTGTTCGCCTTTAACTCGAGTTAAAGGCGAACAAACTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145513
VALIDATED
TIPRL MISSION shRNA Lentiviral Transduction Particles
TIP41, TOR signaling pathway regulator-like (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145513.3-852s21c1
Sequence:CCGGGTTTGTGAGAAGCTCGTATTTCTCGAGAAATACGAGCTTCTCACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145513.3-498s21c1
Sequence:CCGGGTACCTACAACAGATCATATACTCGAGTATATGATCTGTTGTAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145513.3-2235s21c1
Sequence:CCGGGAGTGAAATACAGGGTAATTTCTCGAGAAATTACCCTGTATTTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145513.3-440s1c1
Sequence:CCGGGACCTATACAACAGATTATAACTCGAGTTATAATCTGTTGTATAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145513.3-440s21c1
Sequence:CCGGGACCTATACAACAGATTATAACTCGAGTTATAATCTGTTGTATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145513.3-731s21c1
Sequence:CCGGGACCTACATGTTACGAGAATACTCGAGTATTCTCGTAACATGTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145513.2-850s1c1
Sequence:CCGGGCAGTTTGTGAGAAGCTCGTACTCGAGTACGAGCTTCTCACAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201204    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145513.2-2671s1c1
Sequence:CCGGGCCAACATCTTACTTCAAGATCTCGAGATCTTGAAGTAAGATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201445    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145513.2-1902s1c1
Sequence:CCGGCCCTAGTTTGTTCGCCTTTAACTCGAGTTAAAGGCGAACAAACTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks