EMAIL THIS PAGE TO A FRIEND

TIRAP

toll-interleukin 1 receptor (TIR) domain containing adaptor protein

Synonyms: BACTS1 Mal MyD88-2 wyatt
UniProtKB ID: P58753, B3KW65, Q56UH9, Q56UI0, Q8N5E5
Gene ID:
Human(114609) Summary: The innate immune system recognizes microbial pathogens through Toll-like receptors (TLRs), which identify pathogen-associated molecular patterns. Different TLRs recognize different pathogen-associated molecular patterns and all TLRs have a Toll-interleukin 1 receptor (TIR) domain, which is responsible for signal transduction. The protein encoded by this gene is a TIR adaptor protein involved in the TLR4 signaling pathway of the immune system. It activates NF-kappa-B, MAPK1, MAPK3 and JNK, which then results in cytokine secretion and the inflammatory response. Alternative splicing of this gene results in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
Mouse(117149) toll-interleukin 1 receptor (TIR) domain-containing adaptor protein
Rat(680127) toll-interleukin 1 receptor (TIR) domain-containing adaptor protein
cow(531079) toll-interleukin 1 receptor (TIR) domain containing adaptor protein
sheep(101118490) toll-interleukin 1 receptor (TIR) domain containing adaptor protein
naked mole-rat(101715320) toll-interleukin 1 receptor (TIR) domain containing adaptor protein
domestic guinea pig(100732763) toll-interleukin 1 receptor (TIR) domain containing adaptor protein
Zebrafish(403148) toll-interleukin 1 receptor (TIR) domain containing adaptor protein
chicken(419715) toll-interleukin 1 receptor (TIR) domain containing adaptor protein
dog(609544) toll-interleukin 1 receptor (TIR) domain containing adaptor protein
domestic cat(101088688) toll-interleukin 1 receptor (TIR) domain containing adaptor protein
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054096 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054096 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054096 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052887 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052887 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052887 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_148910 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_148910 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_148910 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039661 Rosetta Predictions human pricing
NM_148910 Rosetta Predictions human pricing
XM_001055833 Rosetta Predictions rat pricing
NM_054096 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206424 predicted 551
2 SASI_Hs01_00206425 predicted 472
3 SASI_Hs01_00206426 predicted 810
4 SASI_Hs01_00206427 predicted 666
5 SASI_Hs01_00206428 predicted 500
6 SASI_Hs01_00206429 predicted 662
7 SASI_Hs01_00206430 predicted 692
8 SASI_Hs01_00206431 predicted 660
9 SASI_Hs01_00206432 predicted 807
10 SASI_Hs02_00308626 predicted 487
11 SASI_Hs01_00206433 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209406 predicted 565
2 SASI_Hs01_00209407 predicted 486
3 SASI_Hs01_00209408 predicted 826
4 SASI_Hs01_00209409 predicted 676
5 SASI_Hs01_00209410 predicted 515
6 SASI_Hs01_00209411 predicted 676
7 SASI_Hs01_00209412 predicted 704
8 SASI_Hs01_00209413 predicted 676
9 SASI_Hs01_00209414 predicted 823
10 SASI_Hs02_00365636 predicted 501
11 SASI_Hs01_00209415 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055833 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281177 predicted 156
2 SASI_Rn02_00281178 predicted 694
3 SASI_Rn02_00281179 predicted 122
4 SASI_Rn02_00281180 predicted 618
5 SASI_Rn02_00281181 predicted 627
6 SASI_Rn02_00281182 predicted 179
7 SASI_Rn02_00281183 predicted 305
8 SASI_Rn02_00281184 predicted 436
9 SASI_Rn02_00281185 predicted 40
10 SASI_Rn02_00281186 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054096 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103365 predicted 1258
2 SASI_Mm01_00103366 predicted 1211
3 SASI_Mm01_00103367 predicted 1130
4 SASI_Mm01_00103368 predicted 1092
5 SASI_Mm01_00103369 predicted 1163
6 SASI_Mm01_00103370 predicted 1155
7 SASI_Mm01_00103371 predicted 1117
8 SASI_Mm01_00103372 predicted 524
9 SASI_Mm02_00338039 predicted 1251
10 SASI_Mm02_00338040 predicted 452
11 SASI_Mm01_00103364 predicted 1037
12 SASI_Mm01_00103373 predicted 1164
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054096
VALIDATED
TIRAP MISSION shRNA Bacterial Glycerol Stock
toll-interleukin 1 receptor (TIR) domain containing adaptor protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054096.1-1675s1c1
Sequence:CCGGCCCATACTGAATTTCACCTTTCTCGAGAAAGGTGAAATTCAGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054096.1-640s1c1
Sequence:CCGGGCAGTTCAGGAATGTCACCTACTCGAGTAGGTGACATTCCTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054096.1-1085s1c1
Sequence:CCGGCCAAGTCAAGGAGGCTGTTATCTCGAGATAACAGCCTCCTTGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054096.1-844s1c1
Sequence:CCGGGCGCCATTGTTTCGGAGCTATCTCGAGATAGCTCCGAAACAATGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054096.1-1038s1c1
Sequence:CCGGCGATTCATGTACTATGTGGATCTCGAGATCCACATAGTACATGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054096.1-1171s21c1
Sequence:CCGGCAGTCATTAATCCAGTATATACTCGAGTATATACTGGATTAATGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054096.1-1085s21c1
Sequence:CCGGCCAAGTCAAGGAGGCTGTTATCTCGAGATAACAGCCTCCTTGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054096.1-640s21c1
Sequence:CCGGGCAGTTCAGGAATGTCACCTACTCGAGTAGGTGACATTCCTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054096.1-522s21c1
Sequence:CCGGCAGGAAAGCCACCTCTATGATCTCGAGATCATAGAGGTGGCTTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054096.1-1127s21c1
Sequence:CCGGCTGACACTTGGGCTTTCATAACTCGAGTTATGAAAGCCCAAGTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054096
VALIDATED
TIRAP MISSION shRNA shRNA Plasmid DNA
toll-interleukin 1 receptor (TIR) domain containing adaptor protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054096.1-1675s1c1
Sequence:CCGGCCCATACTGAATTTCACCTTTCTCGAGAAAGGTGAAATTCAGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054096.1-640s1c1
Sequence:CCGGGCAGTTCAGGAATGTCACCTACTCGAGTAGGTGACATTCCTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054096.1-1085s1c1
Sequence:CCGGCCAAGTCAAGGAGGCTGTTATCTCGAGATAACAGCCTCCTTGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054096.1-844s1c1
Sequence:CCGGGCGCCATTGTTTCGGAGCTATCTCGAGATAGCTCCGAAACAATGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054096.1-1038s1c1
Sequence:CCGGCGATTCATGTACTATGTGGATCTCGAGATCCACATAGTACATGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054096.1-1171s21c1
Sequence:CCGGCAGTCATTAATCCAGTATATACTCGAGTATATACTGGATTAATGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054096.1-1085s21c1
Sequence:CCGGCCAAGTCAAGGAGGCTGTTATCTCGAGATAACAGCCTCCTTGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054096.1-640s21c1
Sequence:CCGGGCAGTTCAGGAATGTCACCTACTCGAGTAGGTGACATTCCTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054096.1-522s21c1
Sequence:CCGGCAGGAAAGCCACCTCTATGATCTCGAGATCATAGAGGTGGCTTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054096.1-1127s21c1
Sequence:CCGGCTGACACTTGGGCTTTCATAACTCGAGTTATGAAAGCCCAAGTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054096
VALIDATED
TIRAP MISSION shRNA Lentiviral Transduction Particles
toll-interleukin 1 receptor (TIR) domain containing adaptor protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054096.1-1675s1c1
Sequence:CCGGCCCATACTGAATTTCACCTTTCTCGAGAAAGGTGAAATTCAGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054096.1-640s1c1
Sequence:CCGGGCAGTTCAGGAATGTCACCTACTCGAGTAGGTGACATTCCTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054096.1-1085s1c1
Sequence:CCGGCCAAGTCAAGGAGGCTGTTATCTCGAGATAACAGCCTCCTTGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054096.1-844s1c1
Sequence:CCGGGCGCCATTGTTTCGGAGCTATCTCGAGATAGCTCCGAAACAATGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054096.1-1038s1c1
Sequence:CCGGCGATTCATGTACTATGTGGATCTCGAGATCCACATAGTACATGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054096.1-1171s21c1
Sequence:CCGGCAGTCATTAATCCAGTATATACTCGAGTATATACTGGATTAATGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054096.1-1085s21c1
Sequence:CCGGCCAAGTCAAGGAGGCTGTTATCTCGAGATAACAGCCTCCTTGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054096.1-640s21c1
Sequence:CCGGGCAGTTCAGGAATGTCACCTACTCGAGTAGGTGACATTCCTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054096.1-522s21c1
Sequence:CCGGCAGGAAAGCCACCTCTATGATCTCGAGATCATAGAGGTGGCTTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054096.1-1127s21c1
Sequence:CCGGCTGACACTTGGGCTTTCATAACTCGAGTTATGAAAGCCCAAGTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052887
TIRAP MISSION shRNA Bacterial Glycerol Stock
toll-interleukin 1 receptor (TIR) domain containing adaptor protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052887.2-1543s1c1
Sequence:CCGGGCCCAGCCTGAAATAATATTTCTCGAGAAATATTATTTCAGGCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052887.2-471s1c1
Sequence:CCGGGCCTAAGAAGCCTCTAGGCAACTCGAGTTGCCTAGAGGCTTCTTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052887.2-563s1c1
Sequence:CCGGCCAGCGATGCTTCACAGCCTACTCGAGTAGGCTGTGAAGCATCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052887.2-1006s1c1
Sequence:CCGGCGATTCATGTACTACGTCGATCTCGAGATCGACGTAGTACATGAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052887.2-1058s1c1
Sequence:CCGGTCAAAGAAGCTGTCATGCGTTCTCGAGAACGCATGACAGCTTCTTTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052887
TIRAP MISSION shRNA shRNA Plasmid DNA
toll-interleukin 1 receptor (TIR) domain containing adaptor protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052887.2-1543s1c1
Sequence:CCGGGCCCAGCCTGAAATAATATTTCTCGAGAAATATTATTTCAGGCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052887.2-471s1c1
Sequence:CCGGGCCTAAGAAGCCTCTAGGCAACTCGAGTTGCCTAGAGGCTTCTTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052887.2-563s1c1
Sequence:CCGGCCAGCGATGCTTCACAGCCTACTCGAGTAGGCTGTGAAGCATCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052887.2-1006s1c1
Sequence:CCGGCGATTCATGTACTACGTCGATCTCGAGATCGACGTAGTACATGAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052887.2-1058s1c1
Sequence:CCGGTCAAAGAAGCTGTCATGCGTTCTCGAGAACGCATGACAGCTTCTTTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052887
TIRAP MISSION shRNA Lentiviral Transduction Particles
toll-interleukin 1 receptor (TIR) domain containing adaptor protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052887.2-1543s1c1
Sequence:CCGGGCCCAGCCTGAAATAATATTTCTCGAGAAATATTATTTCAGGCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052887.2-471s1c1
Sequence:CCGGGCCTAAGAAGCCTCTAGGCAACTCGAGTTGCCTAGAGGCTTCTTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052887.2-563s1c1
Sequence:CCGGCCAGCGATGCTTCACAGCCTACTCGAGTAGGCTGTGAAGCATCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052887.2-1006s1c1
Sequence:CCGGCGATTCATGTACTACGTCGATCTCGAGATCGACGTAGTACATGAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052887.2-1058s1c1
Sequence:CCGGTCAAAGAAGCTGTCATGCGTTCTCGAGAACGCATGACAGCTTCTTTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148910
TIRAP MISSION shRNA Bacterial Glycerol Stock
toll-interleukin 1 receptor (TIR) domain containing adaptor protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148910.2-493s21c1
Sequence:CCGGCTAAGAAGCCTCTAGGCAAGACTCGAGTCTTGCCTAGAGGCTTCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148910.2-687s21c1
Sequence:CCGGAGTAGTCGCTGGAGCAAAGACCTCGAGGTCTTTGCTCCAGCGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148910.2-1015s21c1
Sequence:CCGGCACCTGAGCTCCGATTCATGTCTCGAGACATGAATCGGAGCTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148910.2-856s21c1
Sequence:CCGGAGGCACTGAGCAGTAGTCACTCTCGAGAGTGACTACTGCTCAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148910.2-588s21c1
Sequence:CCGGGATGCTTCACAGCCTACCTCACTCGAGTGAGGTAGGCTGTGAAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148910
TIRAP MISSION shRNA shRNA Plasmid DNA
toll-interleukin 1 receptor (TIR) domain containing adaptor protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148910.2-493s21c1
Sequence:CCGGCTAAGAAGCCTCTAGGCAAGACTCGAGTCTTGCCTAGAGGCTTCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148910.2-687s21c1
Sequence:CCGGAGTAGTCGCTGGAGCAAAGACCTCGAGGTCTTTGCTCCAGCGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148910.2-1015s21c1
Sequence:CCGGCACCTGAGCTCCGATTCATGTCTCGAGACATGAATCGGAGCTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148910.2-856s21c1
Sequence:CCGGAGGCACTGAGCAGTAGTCACTCTCGAGAGTGACTACTGCTCAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148910.2-588s21c1
Sequence:CCGGGATGCTTCACAGCCTACCTCACTCGAGTGAGGTAGGCTGTGAAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148910
TIRAP MISSION shRNA Lentiviral Transduction Particles
toll-interleukin 1 receptor (TIR) domain containing adaptor protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148910.2-493s21c1
Sequence:CCGGCTAAGAAGCCTCTAGGCAAGACTCGAGTCTTGCCTAGAGGCTTCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148910.2-687s21c1
Sequence:CCGGAGTAGTCGCTGGAGCAAAGACCTCGAGGTCTTTGCTCCAGCGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148910.2-1015s21c1
Sequence:CCGGCACCTGAGCTCCGATTCATGTCTCGAGACATGAATCGGAGCTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148910.2-856s21c1
Sequence:CCGGAGGCACTGAGCAGTAGTCACTCTCGAGAGTGACTACTGCTCAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148910.2-588s21c1
Sequence:CCGGGATGCTTCACAGCCTACCTCACTCGAGTGAGGTAGGCTGTGAAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks