EMAIL THIS PAGE TO A FRIEND

TJAP1

tight junction associated protein 1 (peripheral)

Synonyms: PILT TJP4
Gene ID:
Human(93643) Summary: This gene encodes a tight junction-associated protein. Incorporation of the encoded protein into tight junctions occurs at a late stage of formation of the junctions. The encoded protein localizes to the Golgi and may function in vesicle trafficking. Alternatively spliced transcript variants have been described. A related pseudogene exists on the X chromosome. [provided by RefSeq, Mar 2009]
Mouse(74094) tight junction associated protein 1
Rat(316233) tight junction associated protein 1
chicken(421455) tight junction associated protein 1 (peripheral)
dog(481816) tight junction associated protein 1 (peripheral)
Horse(100055288) tight junction associated protein 1 (peripheral)
domestic cat(101087482) tight junction associated protein 1 (peripheral)
domestic guinea pig(100733526) tight junction associated protein 1 (peripheral)
naked mole-rat(101711889) tight junction associated protein 1 (peripheral)
Domestic Rabbit(100351415) tight junction associated protein 1 (peripheral)
cow(515620) tight junction associated protein 1 (peripheral)
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080604 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080604 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080604 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028751 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028751 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028751 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080604 Rosetta Predictions human pricing
NM_001108203 Rosetta Predictions rat pricing
NM_028751 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082154 predicted 637
2 SASI_Hs01_00082155 predicted 2097
3 SASI_Hs01_00082157 predicted 1030
4 SASI_Hs01_00082158 predicted 1065
5 SASI_Hs02_00362339 predicted 1069
6 SASI_Hs01_00082162 predicted 722
7 SASI_Hs01_00082163 predicted 1109
8 SASI_Hs02_00362340 predicted 393
9 SASI_Hs02_00362341 predicted 774
10 SASI_Hs02_00362342 predicted 2105
11 SASI_Hs01_00082156 predicted 1811
12 SASI_Hs01_00082159 predicted 1800
13 SASI_Hs01_00082160 predicted 952
14 SASI_Hs01_00082161 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108203 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236334 predicted 1444
2 SASI_Rn02_00236335 predicted 1432
3 SASI_Rn02_00236336 predicted 2173
4 SASI_Rn02_00236337 predicted 895
5 SASI_Rn02_00236338 predicted 1158
6 SASI_Rn02_00236339 predicted 2628
7 SASI_Rn02_00236340 predicted 1002
8 SASI_Rn02_00236341 predicted 2160
9 SASI_Rn02_00236342 predicted 2388
10 SASI_Rn02_00236343 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028751 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334331 predicted 2106
2 SASI_Mm01_00053337 predicted 661
3 SASI_Mm01_00053338 predicted 1646
4 SASI_Mm01_00053339 predicted 1088
5 SASI_Mm01_00053340 predicted 1733
6 SASI_Mm01_00053342 predicted 1223
7 SASI_Mm01_00053343 predicted 1354
8 SASI_Mm01_00053344 predicted 503
9 SASI_Mm01_00053345 predicted 749
10 SASI_Mm01_00053346 predicted 1141
11 SASI_Mm01_00053341 predicted 1079
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080604
VALIDATED
TJAP1 MISSION shRNA Bacterial Glycerol Stock
tight junction associated protein 1 (peripheral)
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_080604.2-993s21c1
Sequence:CCGGCAGGACATGGTTCGGAAACATCTCGAGATGTTTCCGAACCATGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080604.2-681s21c1
Sequence:CCGGCGCGAGGAGCTGGACAAATTTCTCGAGAAATTTGTCCAGCTCCTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_080604.2-1374s21c1
Sequence:CCGGTATCCTGGCCGCAGGGTAATACTCGAGTATTACCCTGCGGCCAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_080604.2-2383s21c1
Sequence:CCGGGCTGAGGAGTTTATCAGTATTCTCGAGAATACTGATAAACTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080604.2-1087s21c1
Sequence:CCGGCAGTCATTGCCCGAGTGTTAGCTCGAGCTAACACTCGGGCAATGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080604.1-483s1c1
Sequence:CCGGCCTGACTGATGCAGAAAGGATCTCGAGATCCTTTCTGCATCAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080604.1-741s1c1
Sequence:CCGGGAAGGCTGAGATGGATAGGAACTCGAGTTCCTATCCATCTCAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080604.1-1339s1c1
Sequence:CCGGGTAATAGAGTTCTCTGAGGATCTCGAGATCCTCAGAGAACTCTATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_080604.1-2333s1c1
Sequence:CCGGGCTGAGGAGTTTATCAGTATTCTCGAGAATACTGATAAACTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_080604.1-637s1c1
Sequence:CCGGGAGCTGGACAAATTTAAGGATCTCGAGATCCTTAAATTTGTCCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080604.1-1333s1c1
Sequence:CCGGCGCAGGGTAATAGAGTTCTCTCTCGAGAGAGAACTCTATTACCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080604.1-907s1c1
Sequence:CCGGCGAAACCACAAGTTTGCCGATCTCGAGATCGGCAAACTTGTGGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080604.1-1350s1c1
Sequence:CCGGCTCTGAGGATAAGGTTCGGATCTCGAGATCCGAACCTTATCCTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080604.1-943s1c1
Sequence:CCGGCAGGACATGGTTCGGAAACATCTCGAGATGTTTCCGAACCATGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080604.1-900s1c1
Sequence:CCGGCCACTTCCGAAACCACAAGTTCTCGAGAACTTGTGGTTTCGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080604
VALIDATED
TJAP1 MISSION shRNA shRNA Plasmid DNA
tight junction associated protein 1 (peripheral)
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_080604.2-993s21c1
Sequence:CCGGCAGGACATGGTTCGGAAACATCTCGAGATGTTTCCGAACCATGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080604.2-681s21c1
Sequence:CCGGCGCGAGGAGCTGGACAAATTTCTCGAGAAATTTGTCCAGCTCCTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_080604.2-1374s21c1
Sequence:CCGGTATCCTGGCCGCAGGGTAATACTCGAGTATTACCCTGCGGCCAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_080604.2-2383s21c1
Sequence:CCGGGCTGAGGAGTTTATCAGTATTCTCGAGAATACTGATAAACTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080604.2-1087s21c1
Sequence:CCGGCAGTCATTGCCCGAGTGTTAGCTCGAGCTAACACTCGGGCAATGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080604.1-483s1c1
Sequence:CCGGCCTGACTGATGCAGAAAGGATCTCGAGATCCTTTCTGCATCAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080604.1-741s1c1
Sequence:CCGGGAAGGCTGAGATGGATAGGAACTCGAGTTCCTATCCATCTCAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080604.1-1339s1c1
Sequence:CCGGGTAATAGAGTTCTCTGAGGATCTCGAGATCCTCAGAGAACTCTATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_080604.1-2333s1c1
Sequence:CCGGGCTGAGGAGTTTATCAGTATTCTCGAGAATACTGATAAACTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_080604.1-637s1c1
Sequence:CCGGGAGCTGGACAAATTTAAGGATCTCGAGATCCTTAAATTTGTCCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080604.1-1333s1c1
Sequence:CCGGCGCAGGGTAATAGAGTTCTCTCTCGAGAGAGAACTCTATTACCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080604.1-907s1c1
Sequence:CCGGCGAAACCACAAGTTTGCCGATCTCGAGATCGGCAAACTTGTGGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080604.1-1350s1c1
Sequence:CCGGCTCTGAGGATAAGGTTCGGATCTCGAGATCCGAACCTTATCCTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080604.1-943s1c1
Sequence:CCGGCAGGACATGGTTCGGAAACATCTCGAGATGTTTCCGAACCATGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080604.1-900s1c1
Sequence:CCGGCCACTTCCGAAACCACAAGTTCTCGAGAACTTGTGGTTTCGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080604
VALIDATED
TJAP1 MISSION shRNA Lentiviral Transduction Particles
tight junction associated protein 1 (peripheral)
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_080604.2-993s21c1
Sequence:CCGGCAGGACATGGTTCGGAAACATCTCGAGATGTTTCCGAACCATGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080604.2-681s21c1
Sequence:CCGGCGCGAGGAGCTGGACAAATTTCTCGAGAAATTTGTCCAGCTCCTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_080604.2-1374s21c1
Sequence:CCGGTATCCTGGCCGCAGGGTAATACTCGAGTATTACCCTGCGGCCAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_080604.2-2383s21c1
Sequence:CCGGGCTGAGGAGTTTATCAGTATTCTCGAGAATACTGATAAACTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080604.2-1087s21c1
Sequence:CCGGCAGTCATTGCCCGAGTGTTAGCTCGAGCTAACACTCGGGCAATGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080604.1-483s1c1
Sequence:CCGGCCTGACTGATGCAGAAAGGATCTCGAGATCCTTTCTGCATCAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080604.1-741s1c1
Sequence:CCGGGAAGGCTGAGATGGATAGGAACTCGAGTTCCTATCCATCTCAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080604.1-1339s1c1
Sequence:CCGGGTAATAGAGTTCTCTGAGGATCTCGAGATCCTCAGAGAACTCTATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_080604.1-2333s1c1
Sequence:CCGGGCTGAGGAGTTTATCAGTATTCTCGAGAATACTGATAAACTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_080604.1-637s1c1
Sequence:CCGGGAGCTGGACAAATTTAAGGATCTCGAGATCCTTAAATTTGTCCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080604.1-1333s1c1
Sequence:CCGGCGCAGGGTAATAGAGTTCTCTCTCGAGAGAGAACTCTATTACCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080604.1-907s1c1
Sequence:CCGGCGAAACCACAAGTTTGCCGATCTCGAGATCGGCAAACTTGTGGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080604.1-1350s1c1
Sequence:CCGGCTCTGAGGATAAGGTTCGGATCTCGAGATCCGAACCTTATCCTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080604.1-943s1c1
Sequence:CCGGCAGGACATGGTTCGGAAACATCTCGAGATGTTTCCGAACCATGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080604.1-900s1c1
Sequence:CCGGCCACTTCCGAAACCACAAGTTCTCGAGAACTTGTGGTTTCGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028751
VALIDATED
TJAP1 MISSION shRNA Bacterial Glycerol Stock
tight junction associated protein 1 (peripheral)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028751.2-655s21c1
Sequence:CCGGTGAGGAGCTGGACAAGTTTAACTCGAGTTAAACTTGTCCAGCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028751.2-1312s21c1
Sequence:CCGGGTCTCCACCACACCCATTATACTCGAGTATAATGGGTGTGGTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028751.2-828s21c1
Sequence:CCGGATGCCAGGAACACCATCAATACTCGAGTATTGATGGTGTTCCTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028751.2-2331s21c1
Sequence:CCGGTGGTGCTGCTGACCTCTATTCCTCGAGGAATAGAGGTCAGCAGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028751.2-1145s21c1
Sequence:CCGGGCTGAGGATGTATTCGTGCATCTCGAGATGCACGAATACATCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028751.2-1145s1c1
Sequence:CCGGGCTGAGGATGTATTCGTGCATCTCGAGATGCACGAATACATCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028751.2-907s1c1
Sequence:CCGGCAAGTGCAACAAGTCCCACTTCTCGAGAAGTGGGACTTGTTGCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028751.2-1324s1c1
Sequence:CCGGCCCATTATACCCTGGTAGGAACTCGAGTTCCTACCAGGGTATAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028751.2-1672s1c1
Sequence:CCGGGCCCGAGCTACAATTGCATTTCTCGAGAAATGCAATTGTAGCTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028751
VALIDATED
TJAP1 MISSION shRNA shRNA Plasmid DNA
tight junction associated protein 1 (peripheral)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028751.2-655s21c1
Sequence:CCGGTGAGGAGCTGGACAAGTTTAACTCGAGTTAAACTTGTCCAGCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028751.2-1312s21c1
Sequence:CCGGGTCTCCACCACACCCATTATACTCGAGTATAATGGGTGTGGTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028751.2-828s21c1
Sequence:CCGGATGCCAGGAACACCATCAATACTCGAGTATTGATGGTGTTCCTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028751.2-2331s21c1
Sequence:CCGGTGGTGCTGCTGACCTCTATTCCTCGAGGAATAGAGGTCAGCAGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028751.2-1145s21c1
Sequence:CCGGGCTGAGGATGTATTCGTGCATCTCGAGATGCACGAATACATCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028751.2-1145s1c1
Sequence:CCGGGCTGAGGATGTATTCGTGCATCTCGAGATGCACGAATACATCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028751.2-907s1c1
Sequence:CCGGCAAGTGCAACAAGTCCCACTTCTCGAGAAGTGGGACTTGTTGCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028751.2-1324s1c1
Sequence:CCGGCCCATTATACCCTGGTAGGAACTCGAGTTCCTACCAGGGTATAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028751.2-1672s1c1
Sequence:CCGGGCCCGAGCTACAATTGCATTTCTCGAGAAATGCAATTGTAGCTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028751
VALIDATED
TJAP1 MISSION shRNA Lentiviral Transduction Particles
tight junction associated protein 1 (peripheral)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028751.2-655s21c1
Sequence:CCGGTGAGGAGCTGGACAAGTTTAACTCGAGTTAAACTTGTCCAGCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028751.2-1312s21c1
Sequence:CCGGGTCTCCACCACACCCATTATACTCGAGTATAATGGGTGTGGTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028751.2-828s21c1
Sequence:CCGGATGCCAGGAACACCATCAATACTCGAGTATTGATGGTGTTCCTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028751.2-2331s21c1
Sequence:CCGGTGGTGCTGCTGACCTCTATTCCTCGAGGAATAGAGGTCAGCAGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028751.2-1145s21c1
Sequence:CCGGGCTGAGGATGTATTCGTGCATCTCGAGATGCACGAATACATCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028751.2-1145s1c1
Sequence:CCGGGCTGAGGATGTATTCGTGCATCTCGAGATGCACGAATACATCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028751.2-907s1c1
Sequence:CCGGCAAGTGCAACAAGTCCCACTTCTCGAGAAGTGGGACTTGTTGCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028751.2-1324s1c1
Sequence:CCGGCCCATTATACCCTGGTAGGAACTCGAGTTCCTACCAGGGTATAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028751.2-1672s1c1
Sequence:CCGGGCCCGAGCTACAATTGCATTTCTCGAGAAATGCAATTGTAGCTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks