EMAIL THIS PAGE TO A FRIEND

TJP1

tight junction protein 1

Synonyms: ZO-1
UniProtKB ID: Q07157, B4E3K1, Q2NKP3, Q4ZGJ6
Gene ID:
Human(7082) Summary: This gene encodes a protein located on a cytoplasmic membrane surface of intercellular tight junctions. The encoded protein may be involved in signal transduction at cell-cell junctions. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(21872) tight junction protein 1
Rat(292994) tight junction protein 1
cow(407102) tight junction protein 1
Domestic Rabbit(100346390) tight junction protein 1
naked mole-rat(101696637) tight junction protein 1
domestic guinea pig(100718142) tight junction protein 1
chicken(415388) tight junction protein 1 (zona occludens 1)
dog(403752) tight junction protein 1 (zona occludens 1)
domestic cat(101082238) tight junction protein 1
144 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009386 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009386 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009386 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_175610 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175610 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175610 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078241 MISSION® esiRNA esiRNA human TJP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003257 Rosetta Predictions human pricing
NM_175610 Rosetta Predictions human pricing
NM_001106266 Rosetta Predictions rat pricing
NM_009386 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003257 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335302 predicted 1254
2 SASI_Hs01_00167406 predicted 4541
3 SASI_Hs02_00335303 predicted 5064
4 SASI_Hs01_00167407 predicted 2954
5 SASI_Hs01_00167410 predicted 1022
6 SASI_Hs02_00335304 predicted 3689
7 SASI_Hs01_00167412 predicted 2597
8 SASI_Hs02_00335305 predicted 622
9 SASI_Hs01_00167414 predicted 2813
10 SASI_Hs01_00167415 predicted 2529
11 SASI_Hs01_00167408 predicted 3738
12 SASI_Hs01_00167409 predicted 1868
13 SASI_Hs01_00167411 predicted 2733
14 SASI_Hs01_00167413 predicted 3966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175610 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369010 predicted 1258
2 SASI_Hs01_00065350 predicted 4307
3 SASI_Hs02_00369011 predicted 4830
4 SASI_Hs01_00065351 predicted 2946
5 SASI_Hs01_00065354 predicted 1016
6 SASI_Hs02_00369012 predicted 3448
7 SASI_Hs01_00065356 predicted 2603
8 SASI_Hs02_00369013 predicted 617
9 SASI_Hs01_00065358 predicted 2811
10 SASI_Hs01_00065359 predicted 2526
11 SASI_Hs01_00065352 predicted 3495
12 SASI_Hs01_00065353 predicted 1874
13 SASI_Hs01_00065355 predicted 2739
14 SASI_Hs01_00065357 predicted 3722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106266 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217278 predicted 2227
2 SASI_Rn02_00217279 predicted 4683
3 SASI_Rn02_00217280 predicted 1202
4 SASI_Rn02_00217281 predicted 4042
5 SASI_Rn02_00217282 predicted 2159
6 SASI_Rn02_00217283 predicted 784
7 SASI_Rn02_00217284 predicted 4335
8 SASI_Rn02_00217285 predicted 2872
9 SASI_Rn02_00217286 predicted 2687
10 SASI_Rn02_00217287 predicted 3185
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009386 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122383 predicted 2655
2 SASI_Mm01_00122384 predicted 2588
3 SASI_Mm01_00122385 predicted 4411
4 SASI_Mm01_00122386 predicted 5105
5 SASI_Mm02_00316000 predicted 4266
6 SASI_Mm01_00122387 predicted 2525
7 SASI_Mm01_00122388 predicted 1270
8 SASI_Mm01_00122389 predicted 2444
9 SASI_Mm02_00316001 predicted 553
10 SASI_Mm01_00122390 predicted 1626
11 SASI_Mm01_00122391 predicted 4080
12 SASI_Mm01_00122392 predicted 3122
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009386
VALIDATED
TJP1 MISSION shRNA Bacterial Glycerol Stock
tight junction protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009386.1-5678s1c1
Sequence:CCGGCGTGGATTGAACTTACTAAATCTCGAGATTTAGTAAGTTCAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009386.1-3986s1c1
Sequence:CCGGCCGCGAAGTTATGAGCAAGTTCTCGAGAACTTGCTCATAACTTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009386.1-5003s1c1
Sequence:CCGGCGGCCATTTGAACGCAAATTTCTCGAGAAATTTGCGTTCAAATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009386.1-1925s1c1
Sequence:CCGGCGCCGCATTGTAGAATCAGATCTCGAGATCTGATTCTACAATGCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009386.1-4410s1c1
Sequence:CCGGCCGAAGATATTGTTCGATCAACTCGAGTTGATCGAACAATATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009386.1-4410s21c1
Sequence:CCGGCCGAAGATATTGTTCGATCAACTCGAGTTGATCGAACAATATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009386.1-5678s21c1
Sequence:CCGGCGTGGATTGAACTTACTAAATCTCGAGATTTAGTAAGTTCAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009386.1-1925s21c1
Sequence:CCGGCGCCGCATTGTAGAATCAGATCTCGAGATCTGATTCTACAATGCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009386.1-5003s21c1
Sequence:CCGGCGGCCATTTGAACGCAAATTTCTCGAGAAATTTGCGTTCAAATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009386.1-3986s21c1
Sequence:CCGGCCGCGAAGTTATGAGCAAGTTCTCGAGAACTTGCTCATAACTTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009386
VALIDATED
TJP1 MISSION shRNA shRNA Plasmid DNA
tight junction protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009386.1-5678s1c1
Sequence:CCGGCGTGGATTGAACTTACTAAATCTCGAGATTTAGTAAGTTCAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009386.1-3986s1c1
Sequence:CCGGCCGCGAAGTTATGAGCAAGTTCTCGAGAACTTGCTCATAACTTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009386.1-5003s1c1
Sequence:CCGGCGGCCATTTGAACGCAAATTTCTCGAGAAATTTGCGTTCAAATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009386.1-1925s1c1
Sequence:CCGGCGCCGCATTGTAGAATCAGATCTCGAGATCTGATTCTACAATGCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009386.1-4410s1c1
Sequence:CCGGCCGAAGATATTGTTCGATCAACTCGAGTTGATCGAACAATATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009386.1-4410s21c1
Sequence:CCGGCCGAAGATATTGTTCGATCAACTCGAGTTGATCGAACAATATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009386.1-5678s21c1
Sequence:CCGGCGTGGATTGAACTTACTAAATCTCGAGATTTAGTAAGTTCAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009386.1-1925s21c1
Sequence:CCGGCGCCGCATTGTAGAATCAGATCTCGAGATCTGATTCTACAATGCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009386.1-5003s21c1
Sequence:CCGGCGGCCATTTGAACGCAAATTTCTCGAGAAATTTGCGTTCAAATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009386.1-3986s21c1
Sequence:CCGGCCGCGAAGTTATGAGCAAGTTCTCGAGAACTTGCTCATAACTTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009386
VALIDATED
TJP1 MISSION shRNA Lentiviral Transduction Particles
tight junction protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009386.1-5678s1c1
Sequence:CCGGCGTGGATTGAACTTACTAAATCTCGAGATTTAGTAAGTTCAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009386.1-3986s1c1
Sequence:CCGGCCGCGAAGTTATGAGCAAGTTCTCGAGAACTTGCTCATAACTTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009386.1-5003s1c1
Sequence:CCGGCGGCCATTTGAACGCAAATTTCTCGAGAAATTTGCGTTCAAATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009386.1-1925s1c1
Sequence:CCGGCGCCGCATTGTAGAATCAGATCTCGAGATCTGATTCTACAATGCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009386.1-4410s1c1
Sequence:CCGGCCGAAGATATTGTTCGATCAACTCGAGTTGATCGAACAATATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009386.1-4410s21c1
Sequence:CCGGCCGAAGATATTGTTCGATCAACTCGAGTTGATCGAACAATATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009386.1-5678s21c1
Sequence:CCGGCGTGGATTGAACTTACTAAATCTCGAGATTTAGTAAGTTCAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009386.1-1925s21c1
Sequence:CCGGCGCCGCATTGTAGAATCAGATCTCGAGATCTGATTCTACAATGCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009386.1-5003s21c1
Sequence:CCGGCGGCCATTTGAACGCAAATTTCTCGAGAAATTTGCGTTCAAATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009386.1-3986s21c1
Sequence:CCGGCCGCGAAGTTATGAGCAAGTTCTCGAGAACTTGCTCATAACTTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175610
VALIDATED
TJP1 MISSION shRNA Bacterial Glycerol Stock
tight junction protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_175610.1-2544s1c1
Sequence:CCGGGCCTGCATACAATAAAGCAAACTCGAGTTTGCTTTATTGTATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_175610.1-2743s1c1
Sequence:CCGGGCGATCTCATAAACTTCGTAACTCGAGTTACGAAGTTTATGAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_175610.1-6579s1c1
Sequence:CCGGGCAATAAAGCAGCGTTTCTATCTCGAGATAGAAACGCTGCTTTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175610.1-2545s1c1
Sequence:CCGGCCTGCATACAATAAAGCAAATCTCGAGATTTGCTTTATTGTATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_175610.1-4844s1c1
Sequence:CCGGCGACCATTTGAACGCAAGTTTCTCGAGAAACTTGCGTTCAAATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_175610.2-5538s21c1
Sequence:CCGGGGAACCACTCTATCAAGTATTCTCGAGAATACTTGATAGAGTGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175610.2-2743s21c1
Sequence:CCGGGCGATCTCATAAACTTCGTAACTCGAGTTACGAAGTTTATGAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_175610.2-5020s21c1
Sequence:CCGGCCATGCAGAGAAGCCTAAATACTCGAGTATTTAGGCTTCTCTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_175610.2-2460s21c1
Sequence:CCGGCAAGAGAAGAACCAGATATTTCTCGAGAAATATCTGGTTCTTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175610.2-1075s21c1
Sequence:CCGGTCGATTGGCAAGCCATATATTCTCGAGAATATATGGCTTGCCAATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175610
VALIDATED
TJP1 MISSION shRNA shRNA Plasmid DNA
tight junction protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_175610.1-2544s1c1
Sequence:CCGGGCCTGCATACAATAAAGCAAACTCGAGTTTGCTTTATTGTATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_175610.1-2743s1c1
Sequence:CCGGGCGATCTCATAAACTTCGTAACTCGAGTTACGAAGTTTATGAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_175610.1-6579s1c1
Sequence:CCGGGCAATAAAGCAGCGTTTCTATCTCGAGATAGAAACGCTGCTTTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175610.1-2545s1c1
Sequence:CCGGCCTGCATACAATAAAGCAAATCTCGAGATTTGCTTTATTGTATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_175610.1-4844s1c1
Sequence:CCGGCGACCATTTGAACGCAAGTTTCTCGAGAAACTTGCGTTCAAATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_175610.2-5538s21c1
Sequence:CCGGGGAACCACTCTATCAAGTATTCTCGAGAATACTTGATAGAGTGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175610.2-2743s21c1
Sequence:CCGGGCGATCTCATAAACTTCGTAACTCGAGTTACGAAGTTTATGAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_175610.2-5020s21c1
Sequence:CCGGCCATGCAGAGAAGCCTAAATACTCGAGTATTTAGGCTTCTCTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_175610.2-2460s21c1
Sequence:CCGGCAAGAGAAGAACCAGATATTTCTCGAGAAATATCTGGTTCTTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175610.2-1075s21c1
Sequence:CCGGTCGATTGGCAAGCCATATATTCTCGAGAATATATGGCTTGCCAATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175610
VALIDATED
TJP1 MISSION shRNA Lentiviral Transduction Particles
tight junction protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_175610.1-2544s1c1
Sequence:CCGGGCCTGCATACAATAAAGCAAACTCGAGTTTGCTTTATTGTATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_175610.1-2743s1c1
Sequence:CCGGGCGATCTCATAAACTTCGTAACTCGAGTTACGAAGTTTATGAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_175610.1-6579s1c1
Sequence:CCGGGCAATAAAGCAGCGTTTCTATCTCGAGATAGAAACGCTGCTTTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175610.1-2545s1c1
Sequence:CCGGCCTGCATACAATAAAGCAAATCTCGAGATTTGCTTTATTGTATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_175610.1-4844s1c1
Sequence:CCGGCGACCATTTGAACGCAAGTTTCTCGAGAAACTTGCGTTCAAATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_175610.2-5538s21c1
Sequence:CCGGGGAACCACTCTATCAAGTATTCTCGAGAATACTTGATAGAGTGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175610.2-2743s21c1
Sequence:CCGGGCGATCTCATAAACTTCGTAACTCGAGTTACGAAGTTTATGAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_175610.2-5020s21c1
Sequence:CCGGCCATGCAGAGAAGCCTAAATACTCGAGTATTTAGGCTTCTCTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_175610.2-2460s21c1
Sequence:CCGGCAAGAGAAGAACCAGATATTTCTCGAGAAATATCTGGTTCTTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175610.2-1075s21c1
Sequence:CCGGTCGATTGGCAAGCCATATATTCTCGAGAATATATGGCTTGCCAATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks