EMAIL THIS PAGE TO A FRIEND

TJP2

tight junction protein 2

Synonyms: C9DUPq21.11 DFNA51 DUP9q21.11 X104 ZO2
Gene ID:
Human(9414) Summary: This gene encodes a zonula occluden that is a member of the membrane-associated guanylate kinase homolog family. The encoded protein functions as a component of the tight junction barrier in epithelial and endothelial cells and is necessary for proper assembly of tight junctions. Mutations in this gene have been identified in patients with hypercholanemia, and genomic duplication of a 270 kb region including this gene causes autosomal dominant deafness-51. Alternatively spliced transcripts encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Mouse(21873) tight junction protein 2
Rat(115769) tight junction protein 2
chicken(395751) tight junction protein 2 (zona occludens 2)
domestic cat(101081681) tight junction protein 2
dog(403854) tight junction protein 2 (zona occludens 2)
domestic guinea pig(100729549) tight junction protein 2
naked mole-rat(101722709) tight junction protein 2
Domestic Rabbit(100356517) tight junction protein 2
cow(407101) tight junction protein 2 (zona occludens 2)
152 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011597 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011597 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011597 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004817 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004817 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004817 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004817 Rosetta Predictions human pricing
NM_201629 Rosetta Predictions human pricing
NM_053773 Rosetta Predictions rat pricing
NM_011597 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004817 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338371 predicted 3835
2 SASI_Hs01_00204878 predicted 2195
3 SASI_Hs01_00204879 predicted 2662
4 SASI_Hs01_00204880 predicted 1698
5 SASI_Hs01_00204881 predicted 1937
6 SASI_Hs01_00204882 predicted 2764
7 SASI_Hs01_00204884 predicted 270
8 SASI_Hs01_00204885 predicted 2670
9 SASI_Hs01_00204886 predicted 2538
10 SASI_Hs01_00204887 predicted 380
11 SASI_Hs01_00204883 predicted 1464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201629 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373145 predicted 3393
2 SASI_Hs01_00023380 predicted 2191
3 SASI_Hs01_00023381 predicted 2669
4 SASI_Hs01_00023382 predicted 1706
5 SASI_Hs01_00023383 predicted 1935
6 SASI_Hs01_00023384 predicted 2769
7 SASI_Hs01_00023386 predicted 274
8 SASI_Hs01_00023387 predicted 2671
9 SASI_Hs01_00023388 predicted 2529
10 SASI_Hs01_00023389 predicted 378
11 SASI_Hs01_00023385 predicted 1461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053773 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051843 predicted 1758
2 SASI_Rn01_00051844 predicted 1825
3 SASI_Rn01_00051845 predicted 318
4 SASI_Rn01_00051846 predicted 2690
5 SASI_Rn01_00051847 predicted 980
6 SASI_Rn02_00266572 predicted 641
7 SASI_Rn01_00051848 predicted 3579
8 SASI_Rn01_00051849 predicted 1842
9 SASI_Rn01_00051850 predicted 3791
10 SASI_Rn01_00051851 predicted 1298
11 SASI_Rn01_00051842 predicted 3548
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011597 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157868 predicted 779
2 SASI_Mm01_00157869 predicted 1262
3 SASI_Mm02_00321011 predicted 2746
4 SASI_Mm01_00157870 predicted 926
5 SASI_Mm01_00157871 predicted 1558
6 SASI_Mm02_00321012 predicted 2176
7 SASI_Mm01_00157872 predicted 1629
8 SASI_Mm01_00157873 predicted 2503
9 SASI_Mm01_00157874 predicted 1646
10 SASI_Mm01_00157875 predicted 3382
11 SASI_Mm01_00157867 predicted 2216
12 SASI_Mm01_00157876 predicted 3633
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011597
VALIDATED
TJP2 MISSION shRNA Bacterial Glycerol Stock
tight junction protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011597.3-3923s21c1
Sequence:CCGGAGATGTGAAGAGGGAGTTAAACTCGAGTTTAACTCCCTCTTCACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011597.3-2505s21c1
Sequence:CCGGGATTCCAGACAAGGTGTTAAACTCGAGTTTAACACCTTGTCTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011597.3-4053s21c1
Sequence:CCGGGCTTCATGCAAACCCATAATGCTCGAGCATTATGGGTTTGCATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011597.3-1636s21c1
Sequence:CCGGGAAACGACGTTGGGATATTTGCTCGAGCAAATATCCCAACGTCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011597.3-3355s21c1
Sequence:CCGGAGAATGCGAGGATCGAAATAGCTCGAGCTATTTCGATCCTCGCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011597.1-3639s1c1
Sequence:CCGGCGGCATGAGTTACCAACTGAACTCGAGTTCAGTTGGTAACTCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011597.1-1045s1c1
Sequence:CCGGCGGCACTGTTACTGAGAACATCTCGAGATGTTCTCAGTAACAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011597.1-713s1c1
Sequence:CCGGCGCTCCTATCACGAAGCTTATCTCGAGATAAGCTTCGTGATAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011597.1-3007s1c1
Sequence:CCGGCTTCGACTACTCCAAGTCAAACTCGAGTTTGACTTGGAGTAGTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011597.1-2780s1c1
Sequence:CCGGGCCTACACTGACAATGAGCTACTCGAGTAGCTCATTGTCAGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011597
VALIDATED
TJP2 MISSION shRNA shRNA Plasmid DNA
tight junction protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011597.3-3923s21c1
Sequence:CCGGAGATGTGAAGAGGGAGTTAAACTCGAGTTTAACTCCCTCTTCACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011597.3-2505s21c1
Sequence:CCGGGATTCCAGACAAGGTGTTAAACTCGAGTTTAACACCTTGTCTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011597.3-4053s21c1
Sequence:CCGGGCTTCATGCAAACCCATAATGCTCGAGCATTATGGGTTTGCATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011597.3-1636s21c1
Sequence:CCGGGAAACGACGTTGGGATATTTGCTCGAGCAAATATCCCAACGTCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011597.3-3355s21c1
Sequence:CCGGAGAATGCGAGGATCGAAATAGCTCGAGCTATTTCGATCCTCGCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011597.1-3639s1c1
Sequence:CCGGCGGCATGAGTTACCAACTGAACTCGAGTTCAGTTGGTAACTCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011597.1-1045s1c1
Sequence:CCGGCGGCACTGTTACTGAGAACATCTCGAGATGTTCTCAGTAACAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011597.1-713s1c1
Sequence:CCGGCGCTCCTATCACGAAGCTTATCTCGAGATAAGCTTCGTGATAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011597.1-3007s1c1
Sequence:CCGGCTTCGACTACTCCAAGTCAAACTCGAGTTTGACTTGGAGTAGTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011597.1-2780s1c1
Sequence:CCGGGCCTACACTGACAATGAGCTACTCGAGTAGCTCATTGTCAGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011597
VALIDATED
TJP2 MISSION shRNA Lentiviral Transduction Particles
tight junction protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011597.3-3923s21c1
Sequence:CCGGAGATGTGAAGAGGGAGTTAAACTCGAGTTTAACTCCCTCTTCACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011597.3-2505s21c1
Sequence:CCGGGATTCCAGACAAGGTGTTAAACTCGAGTTTAACACCTTGTCTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011597.3-4053s21c1
Sequence:CCGGGCTTCATGCAAACCCATAATGCTCGAGCATTATGGGTTTGCATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011597.3-1636s21c1
Sequence:CCGGGAAACGACGTTGGGATATTTGCTCGAGCAAATATCCCAACGTCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011597.3-3355s21c1
Sequence:CCGGAGAATGCGAGGATCGAAATAGCTCGAGCTATTTCGATCCTCGCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011597.1-3639s1c1
Sequence:CCGGCGGCATGAGTTACCAACTGAACTCGAGTTCAGTTGGTAACTCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011597.1-1045s1c1
Sequence:CCGGCGGCACTGTTACTGAGAACATCTCGAGATGTTCTCAGTAACAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011597.1-713s1c1
Sequence:CCGGCGCTCCTATCACGAAGCTTATCTCGAGATAAGCTTCGTGATAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011597.1-3007s1c1
Sequence:CCGGCTTCGACTACTCCAAGTCAAACTCGAGTTTGACTTGGAGTAGTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011597.1-2780s1c1
Sequence:CCGGGCCTACACTGACAATGAGCTACTCGAGTAGCTCATTGTCAGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004817
VALIDATED
TJP2 MISSION shRNA Bacterial Glycerol Stock
tight junction protein 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315397    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004817.2-4268s21c1
Sequence:CCGGGCTTTAGGCAGAGCCATAATGCTCGAGCATTATGGCTCTGCCTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004817.2-1422s21c1
Sequence:CCGGATAGAGTCAAACCGATCATTTCTCGAGAAATGATCGGTTTGACTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004817.2-1458s21c1
Sequence:CCGGCGTCATCAGTATTCTGATTATCTCGAGATAATCAGAATACTGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004817.2-3327s21c1
Sequence:CCGGCCTACCTTTGGGCGGTCTATACTCGAGTATAGACCGCCCAAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004817.2-1782s21c1
Sequence:CCGGGGCAATGATGTCGGGATATTTCTCGAGAAATATCCCGACATCATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004817.2-1709s21c1
Sequence:CCGGAGCAATATATGGCCCTAATACCTCGAGGTATTAGGGCCATATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004817.2-2094s1c1
Sequence:CCGGCGAGTGGTAGACACACTGTATCTCGAGATACAGTGTGTCTACCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004817.2-2523s1c1
Sequence:CCGGCGGTTAAATACCGTGAGGCAACTCGAGTTGCCTCACGGTATTTAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004817.2-1458s1c1
Sequence:CCGGCGTCATCAGTATTCTGATTATCTCGAGATAATCAGAATACTGATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004817.2-4318s1c1
Sequence:CCGGCCAGCTTAATAGCTGTAGTTTCTCGAGAAACTACAGCTATTAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004817.2-3136s1c1
Sequence:CCGGGCGATCAACTTAGGGACAATACTCGAGTATTGTCCCTAAGTTGATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004817
VALIDATED
TJP2 MISSION shRNA shRNA Plasmid DNA
tight junction protein 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315397    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004817.2-4268s21c1
Sequence:CCGGGCTTTAGGCAGAGCCATAATGCTCGAGCATTATGGCTCTGCCTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004817.2-1422s21c1
Sequence:CCGGATAGAGTCAAACCGATCATTTCTCGAGAAATGATCGGTTTGACTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004817.2-1458s21c1
Sequence:CCGGCGTCATCAGTATTCTGATTATCTCGAGATAATCAGAATACTGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004817.2-3327s21c1
Sequence:CCGGCCTACCTTTGGGCGGTCTATACTCGAGTATAGACCGCCCAAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004817.2-1782s21c1
Sequence:CCGGGGCAATGATGTCGGGATATTTCTCGAGAAATATCCCGACATCATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004817.2-1709s21c1
Sequence:CCGGAGCAATATATGGCCCTAATACCTCGAGGTATTAGGGCCATATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004817.2-2094s1c1
Sequence:CCGGCGAGTGGTAGACACACTGTATCTCGAGATACAGTGTGTCTACCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004817.2-2523s1c1
Sequence:CCGGCGGTTAAATACCGTGAGGCAACTCGAGTTGCCTCACGGTATTTAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004817.2-1458s1c1
Sequence:CCGGCGTCATCAGTATTCTGATTATCTCGAGATAATCAGAATACTGATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004817.2-4318s1c1
Sequence:CCGGCCAGCTTAATAGCTGTAGTTTCTCGAGAAACTACAGCTATTAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004817.2-3136s1c1
Sequence:CCGGGCGATCAACTTAGGGACAATACTCGAGTATTGTCCCTAAGTTGATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004817
VALIDATED
TJP2 MISSION shRNA Lentiviral Transduction Particles
tight junction protein 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315397    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004817.2-4268s21c1
Sequence:CCGGGCTTTAGGCAGAGCCATAATGCTCGAGCATTATGGCTCTGCCTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004817.2-1422s21c1
Sequence:CCGGATAGAGTCAAACCGATCATTTCTCGAGAAATGATCGGTTTGACTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004817.2-1458s21c1
Sequence:CCGGCGTCATCAGTATTCTGATTATCTCGAGATAATCAGAATACTGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004817.2-3327s21c1
Sequence:CCGGCCTACCTTTGGGCGGTCTATACTCGAGTATAGACCGCCCAAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004817.2-1782s21c1
Sequence:CCGGGGCAATGATGTCGGGATATTTCTCGAGAAATATCCCGACATCATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004817.2-1709s21c1
Sequence:CCGGAGCAATATATGGCCCTAATACCTCGAGGTATTAGGGCCATATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004817.2-2094s1c1
Sequence:CCGGCGAGTGGTAGACACACTGTATCTCGAGATACAGTGTGTCTACCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004817.2-2523s1c1
Sequence:CCGGCGGTTAAATACCGTGAGGCAACTCGAGTTGCCTCACGGTATTTAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004817.2-1458s1c1
Sequence:CCGGCGTCATCAGTATTCTGATTATCTCGAGATAATCAGAATACTGATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004817.2-4318s1c1
Sequence:CCGGCCAGCTTAATAGCTGTAGTTTCTCGAGAAACTACAGCTATTAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004817.2-3136s1c1
Sequence:CCGGGCGATCAACTTAGGGACAATACTCGAGTATTGTCCCTAAGTTGATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks