EMAIL THIS PAGE TO A FRIEND

TJP3

tight junction protein 3

Synonyms: ZO-3 ZO3
UniProtKB ID: O95049, A6NFP3, B3KXZ0, K7EK22, Q32N01
Gene ID:
Human(27134) Summary: The protein encoded by this gene is a member of the membrane-associated guanylate kinase-like (MAGUK) protein family which is characterized by members having multiple PDZ domains, a single SH3 domain, and a single guanylate kinase-like (GUK)-domain. In addition, members of the zonula occludens protein subfamily have an acidic domain, a basic arginine-rich region, and a proline-rich domain. The protein encoded by this gene plays a role in the linkage between the actin cytoskeleton and tight-junctions and also sequesters cyclin D1 at tight junctions during mitosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. This gene has a partial pseudogene on chromosome 1. [provided by RefSeq, May 2012]
Mouse(27375) tight junction protein 3
Rat(314640) tight junction protein 3
Zebrafish(373089) tight junction protein 3
Horse(100066918) tight junction protein 3
domestic cat(101098036) tight junction protein 3
dog(403852) tight junction protein 3
chicken(420070) tight junction protein 3 (zona occludens 3)
cow(407100) tight junction protein 3 (zona occludens 3)
naked mole-rat(101702864) tight junction protein 3
domestic guinea pig(100718150) tight junction protein 3
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013769 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013769 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013769 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014428 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014428 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014428 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014428 Rosetta Predictions human pricing
NM_001108073 Rosetta Predictions rat pricing
NM_013769 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014428 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148825 predicted 2063
2 SASI_Hs01_00148826 predicted 1291
3 SASI_Hs01_00148828 predicted 2495
4 SASI_Hs01_00148829 predicted 1528
5 SASI_Hs01_00148830 predicted 688
6 SASI_Hs01_00148831 predicted 1359
7 SASI_Hs01_00148832 predicted 1174
8 SASI_Hs01_00148833 predicted 781
9 SASI_Hs01_00148834 predicted 282
10 SASI_Hs02_00345633 predicted 816
11 SASI_Hs01_00148827 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108073 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235084 predicted 2090
2 SASI_Rn02_00235085 predicted 668
3 SASI_Rn02_00235086 predicted 1543
4 SASI_Rn02_00235087 predicted 1200
5 SASI_Rn02_00235088 predicted 745
6 SASI_Rn02_00235089 predicted 828
7 SASI_Rn02_00235090 predicted 382
8 SASI_Rn02_00235091 predicted 355
9 SASI_Rn02_00235092 predicted 693
10 SASI_Rn02_00235093 predicted 996
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013769 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322719 predicted 1563
2 SASI_Mm01_00138229 predicted 1621
3 SASI_Mm01_00138231 predicted 740
4 SASI_Mm01_00138232 predicted 767
5 SASI_Mm01_00138234 predicted 1264
6 SASI_Mm01_00138235 predicted 431
7 SASI_Mm01_00138236 predicted 2208
8 SASI_Mm01_00138237 predicted 2163
9 SASI_Mm01_00138238 predicted 775
10 SASI_Mm02_00322720 predicted 904
11 SASI_Mm01_00138230 predicted 1048
12 SASI_Mm01_00138233 predicted 2743
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013769
TJP3 MISSION shRNA Bacterial Glycerol Stock
tight junction protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013769.1-1239s1c1
Sequence:CCGGCGCTATGACATTTACAGGGTTCTCGAGAACCCTGTAAATGTCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013769.1-732s1c1
Sequence:CCGGGATGTGCTAATGAGGCCACTACTCGAGTAGTGGCCTCATTAGCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013769.1-1442s1c1
Sequence:CCGGGCAGGTGAATGGTATGCCATTCTCGAGAATGGCATACCATTCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013769.1-1441s1c1
Sequence:CCGGTGCAGGTGAATGGTATGCCATCTCGAGATGGCATACCATTCACCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013769.1-2097s1c1
Sequence:CCGGGAAGAGTTTGAGATTGCAGAACTCGAGTTCTGCAATCTCAAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013769
TJP3 MISSION shRNA shRNA Plasmid DNA
tight junction protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013769.1-1239s1c1
Sequence:CCGGCGCTATGACATTTACAGGGTTCTCGAGAACCCTGTAAATGTCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013769.1-732s1c1
Sequence:CCGGGATGTGCTAATGAGGCCACTACTCGAGTAGTGGCCTCATTAGCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013769.1-1442s1c1
Sequence:CCGGGCAGGTGAATGGTATGCCATTCTCGAGAATGGCATACCATTCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013769.1-1441s1c1
Sequence:CCGGTGCAGGTGAATGGTATGCCATCTCGAGATGGCATACCATTCACCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013769.1-2097s1c1
Sequence:CCGGGAAGAGTTTGAGATTGCAGAACTCGAGTTCTGCAATCTCAAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013769
TJP3 MISSION shRNA Lentiviral Transduction Particles
tight junction protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013769.1-1239s1c1
Sequence:CCGGCGCTATGACATTTACAGGGTTCTCGAGAACCCTGTAAATGTCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013769.1-732s1c1
Sequence:CCGGGATGTGCTAATGAGGCCACTACTCGAGTAGTGGCCTCATTAGCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013769.1-1442s1c1
Sequence:CCGGGCAGGTGAATGGTATGCCATTCTCGAGAATGGCATACCATTCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013769.1-1441s1c1
Sequence:CCGGTGCAGGTGAATGGTATGCCATCTCGAGATGGCATACCATTCACCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013769.1-2097s1c1
Sequence:CCGGGAAGAGTTTGAGATTGCAGAACTCGAGTTCTGCAATCTCAAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014428
TJP3 MISSION shRNA Bacterial Glycerol Stock
tight junction protein 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014428.1-1983s1c1
Sequence:CCGGCGACATTGCTATGCAGAAGTTCTCGAGAACTTCTGCATAGCAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014428.1-825s1c1
Sequence:CCGGGATTGAGAAGTCAGAAGGGAACTCGAGTTCCCTTCTGACTTCTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014428.1-2151s1c1
Sequence:CCGGGCGCCTCAACTATGTGCAGTACTCGAGTACTGCACATAGTTGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014428.1-285s1c1
Sequence:CCGGGATACTCAAGACCTGCACCAACTCGAGTTGGTGCAGGTCTTGAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014428.1-829s1c1
Sequence:CCGGGAGAAGTCAGAAGGGAAGCTACTCGAGTAGCTTCCCTTCTGACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014428.1-875s21c1
Sequence:CCGGGGCAGTTCCTGGTGAACATTCCTCGAGGAATGTTCACCAGGAACTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014428
TJP3 MISSION shRNA shRNA Plasmid DNA
tight junction protein 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014428.1-1983s1c1
Sequence:CCGGCGACATTGCTATGCAGAAGTTCTCGAGAACTTCTGCATAGCAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014428.1-825s1c1
Sequence:CCGGGATTGAGAAGTCAGAAGGGAACTCGAGTTCCCTTCTGACTTCTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014428.1-2151s1c1
Sequence:CCGGGCGCCTCAACTATGTGCAGTACTCGAGTACTGCACATAGTTGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014428.1-285s1c1
Sequence:CCGGGATACTCAAGACCTGCACCAACTCGAGTTGGTGCAGGTCTTGAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014428.1-829s1c1
Sequence:CCGGGAGAAGTCAGAAGGGAAGCTACTCGAGTAGCTTCCCTTCTGACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014428.1-875s21c1
Sequence:CCGGGGCAGTTCCTGGTGAACATTCCTCGAGGAATGTTCACCAGGAACTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014428
TJP3 MISSION shRNA Lentiviral Transduction Particles
tight junction protein 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014428.1-1983s1c1
Sequence:CCGGCGACATTGCTATGCAGAAGTTCTCGAGAACTTCTGCATAGCAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014428.1-825s1c1
Sequence:CCGGGATTGAGAAGTCAGAAGGGAACTCGAGTTCCCTTCTGACTTCTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014428.1-2151s1c1
Sequence:CCGGGCGCCTCAACTATGTGCAGTACTCGAGTACTGCACATAGTTGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014428.1-285s1c1
Sequence:CCGGGATACTCAAGACCTGCACCAACTCGAGTTGGTGCAGGTCTTGAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014428.1-829s1c1
Sequence:CCGGGAGAAGTCAGAAGGGAAGCTACTCGAGTAGCTTCCCTTCTGACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014428.1-875s21c1
Sequence:CCGGGGCAGTTCCTGGTGAACATTCCTCGAGGAATGTTCACCAGGAACTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks