EMAIL THIS PAGE TO A FRIEND

TK1

thymidine kinase 1, soluble

Synonyms: TK2
UniProtKB ID: P04183, B2RC58, Q969V0, Q9UMG9
Gene ID:
Mouse(21877) thymidine kinase 1
Rat(24834) thymidine kinase 1, soluble
cow(504652) thymidine kinase 1, soluble
sheep(101114036) thymidine kinase 1, soluble
domestic guinea pig(100730805) thymidine kinase 1, soluble
naked mole-rat(101702833) thymidine kinase 1, soluble
Zebrafish(327590) thymidine kinase 1, soluble
dog(483343) thymidine kinase 1, soluble
domestic cat(101101270) thymidine kinase 1, soluble
chicken(395719) thymidine kinase 1, soluble
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502977 Anti-KITH, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB4504000 Anti-phospho-TK (pSer13) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4301523 Anti-phospho-TK (pSer13) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4502976 Anti-TK, N-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
SAB1406531 Anti-TK1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2107332 Anti-TK1 antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, mouse, horse, human
ELISA, western blot pricing
SAB1411350 Anti-TK1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
WH0007083M2 Monoclonal Anti-TK1 antibody produced in mouse clone F12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1404473 Monoclonal Anti-TK1 antibody produced in mouse clone 1D10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409742 Monoclonal Anti-TK1 antibody produced in mouse clone 3G11, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409743 Monoclonal Anti-TK1 antibody produced in mouse clone 2F7, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409744 Monoclonal Anti-TK1 antibody produced in mouse clone 2G8, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003258 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003258 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003258 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009387 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009387 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009387 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153271 MISSION® esiRNA esiRNA human TK1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003258 siRNAs that have been validated in the lab human pricing
NM_052800 Rosetta Predictions rat pricing
NM_009387 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003258 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178717 validated 379
1 SASI_Hs01_00178715 validated 203
1 SASI_Hs01_00178716 validated 608
2 SASI_Hs02_00335306 predicted 361
3 SASI_Hs02_00335307 predicted 1012
4 SASI_Hs01_00178718 predicted 1082
5 SASI_Hs02_00335308 predicted 342
6 SASI_Hs01_00178719 predicted 693
7 SASI_Hs02_00335309 predicted 217
8 SASI_Hs02_00335310 predicted 332
9 SASI_Hs01_00178720 predicted 555
10 SASI_Hs02_00335311 predicted 400
11 SASI_Hs01_00178721 predicted 1162
12 SASI_Hs01_00178722 predicted 969
13 SASI_Hs01_00178723 predicted 954
14 SASI_Hs01_00178724 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052800 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265581 predicted 737
2 SASI_Rn02_00265582 predicted 576
3 SASI_Rn02_00265583 predicted 937
4 SASI_Rn02_00265584 predicted 394
5 SASI_Rn02_00265585 predicted 838
6 SASI_Rn02_00265586 predicted 954
7 SASI_Rn02_00265587 predicted 414
8 SASI_Rn02_00265588 predicted 931
9 SASI_Rn02_00265589 predicted 842
10 SASI_Rn02_00265590 predicted 879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009387 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148986 predicted 934
2 SASI_Mm01_00148987 predicted 954
3 SASI_Mm01_00148985 predicted 809
4 SASI_Mm01_00148988 predicted 752
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003258
VALIDATED
TK1 MISSION shRNA Bacterial Glycerol Stock
thymidine kinase 1, soluble
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003258.4-1378s21c1
Sequence:GTACCGGGGATTCACGCCCTCTTGTTTCCTCGAGGAAACAAGAGGGCGTGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003258.4-377s21c1
Sequence:CCGGCCAAAGACACTCGCTACAGCACTCGAGTGCTGTAGCGAGTGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003258.4-480s21c1
Sequence:CCGGCGTGGCTGTCATAGGCATCGACTCGAGTCGATGCCTATGACAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003258.4-763s21c1
Sequence:CCGGTGTCGGCTCTGCTACTTCAAGCTCGAGCTTGAAGTAGCAGAGCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003258.4-683s21c1
Sequence:CCGGGGGAAGCCGCCTATACCAAGACTCGAGTCTTGGTATAGGCGGCTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003258.x-610s1c1
Sequence:CCGGTGTCGGCTCTGCTACTTCAAGCTCGAGCTTGAAGTAGCAGAGCCGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003258.x-530s1c1
Sequence:CCGGGGGAAGCCGCCTATACCAAGACTCGAGTCTTGGTATAGGCGGCTTCCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003258.x-224s1c1
Sequence:CCGGCCAAAGACACTCGCTACAGCACTCGAGTGCTGTAGCGAGTGTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003258.x-327s1c1
Sequence:CCGGCGTGGCTGTCATAGGCATCGACTCGAGTCGATGCCTATGACAGCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003258.x-407s1c1
Sequence:CCGGAGACCGTAATTGTGGCTGCACCTCGAGGTGCAGCCACAATTACGGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003258
VALIDATED
TK1 MISSION shRNA shRNA Plasmid DNA
thymidine kinase 1, soluble
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003258.4-1378s21c1
Sequence:GTACCGGGGATTCACGCCCTCTTGTTTCCTCGAGGAAACAAGAGGGCGTGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003258.4-377s21c1
Sequence:CCGGCCAAAGACACTCGCTACAGCACTCGAGTGCTGTAGCGAGTGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003258.4-480s21c1
Sequence:CCGGCGTGGCTGTCATAGGCATCGACTCGAGTCGATGCCTATGACAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003258.4-763s21c1
Sequence:CCGGTGTCGGCTCTGCTACTTCAAGCTCGAGCTTGAAGTAGCAGAGCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003258.4-683s21c1
Sequence:CCGGGGGAAGCCGCCTATACCAAGACTCGAGTCTTGGTATAGGCGGCTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003258.x-610s1c1
Sequence:CCGGTGTCGGCTCTGCTACTTCAAGCTCGAGCTTGAAGTAGCAGAGCCGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003258.x-530s1c1
Sequence:CCGGGGGAAGCCGCCTATACCAAGACTCGAGTCTTGGTATAGGCGGCTTCCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003258.x-224s1c1
Sequence:CCGGCCAAAGACACTCGCTACAGCACTCGAGTGCTGTAGCGAGTGTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003258.x-327s1c1
Sequence:CCGGCGTGGCTGTCATAGGCATCGACTCGAGTCGATGCCTATGACAGCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003258.x-407s1c1
Sequence:CCGGAGACCGTAATTGTGGCTGCACCTCGAGGTGCAGCCACAATTACGGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003258
VALIDATED
TK1 MISSION shRNA Lentiviral Transduction Particles
thymidine kinase 1, soluble
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003258.4-1378s21c1
Sequence:GTACCGGGGATTCACGCCCTCTTGTTTCCTCGAGGAAACAAGAGGGCGTGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003258.4-377s21c1
Sequence:CCGGCCAAAGACACTCGCTACAGCACTCGAGTGCTGTAGCGAGTGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003258.4-480s21c1
Sequence:CCGGCGTGGCTGTCATAGGCATCGACTCGAGTCGATGCCTATGACAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003258.4-763s21c1
Sequence:CCGGTGTCGGCTCTGCTACTTCAAGCTCGAGCTTGAAGTAGCAGAGCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003258.4-683s21c1
Sequence:CCGGGGGAAGCCGCCTATACCAAGACTCGAGTCTTGGTATAGGCGGCTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003258.x-610s1c1
Sequence:CCGGTGTCGGCTCTGCTACTTCAAGCTCGAGCTTGAAGTAGCAGAGCCGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003258.x-530s1c1
Sequence:CCGGGGGAAGCCGCCTATACCAAGACTCGAGTCTTGGTATAGGCGGCTTCCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003258.x-224s1c1
Sequence:CCGGCCAAAGACACTCGCTACAGCACTCGAGTGCTGTAGCGAGTGTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003258.x-327s1c1
Sequence:CCGGCGTGGCTGTCATAGGCATCGACTCGAGTCGATGCCTATGACAGCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003258.x-407s1c1
Sequence:CCGGAGACCGTAATTGTGGCTGCACCTCGAGGTGCAGCCACAATTACGGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009387
VALIDATED
TK1 MISSION shRNA Bacterial Glycerol Stock
thymidine kinase 1, soluble
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009387.2-832s21c1
Sequence:CCGGCTCAGACAACAAGAACTGTCTCTCGAGAGACAGTTCTTGTTGTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322049    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009387.2-1014s21c1
Sequence:CCGGATGGACAATGTACCTTGAACACTCGAGTGTTCAAGGTACATTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009387.2-1003s21c1
Sequence:CCGGTGCCATTCCTAATGGACAATGCTCGAGCATTGTCCATTAGGAATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009387.2-790s21c1
Sequence:CCGGCCGCCTGTGCTACTTTAAGAACTCGAGTTCTTAAAGTAGCACAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009387.2-900s21c1
Sequence:CCGGCCTCTCAGCAAGTCCTACAATCTCGAGATTGTAGGACTTGCTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009387.1-837s1c1
Sequence:CCGGCCTCTCAGCAAGTCCTACAATCTCGAGATTGTAGGACTTGCTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009387.1-769s1c1
Sequence:CCGGCTCAGACAACAAGAACTGTCTCTCGAGAGACAGTTCTTGTTGTCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009387.1-850s1c1
Sequence:CCGGCCTACAATACAACTCTGCCAACTCGAGTTGGCAGAGTTGTATTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009387.1-727s1c1
Sequence:CCGGCCGCCTGTGCTACTTTAAGAACTCGAGTTCTTAAAGTAGCACAGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009387.1-322s1c1
Sequence:CCGGCCTGGTCATCAAGTATGCCAACTCGAGTTGGCATACTTGATGACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009387
VALIDATED
TK1 MISSION shRNA shRNA Plasmid DNA
thymidine kinase 1, soluble
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009387.2-832s21c1
Sequence:CCGGCTCAGACAACAAGAACTGTCTCTCGAGAGACAGTTCTTGTTGTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322049    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009387.2-1014s21c1
Sequence:CCGGATGGACAATGTACCTTGAACACTCGAGTGTTCAAGGTACATTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009387.2-1003s21c1
Sequence:CCGGTGCCATTCCTAATGGACAATGCTCGAGCATTGTCCATTAGGAATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009387.2-790s21c1
Sequence:CCGGCCGCCTGTGCTACTTTAAGAACTCGAGTTCTTAAAGTAGCACAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009387.2-900s21c1
Sequence:CCGGCCTCTCAGCAAGTCCTACAATCTCGAGATTGTAGGACTTGCTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009387.1-837s1c1
Sequence:CCGGCCTCTCAGCAAGTCCTACAATCTCGAGATTGTAGGACTTGCTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009387.1-769s1c1
Sequence:CCGGCTCAGACAACAAGAACTGTCTCTCGAGAGACAGTTCTTGTTGTCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009387.1-850s1c1
Sequence:CCGGCCTACAATACAACTCTGCCAACTCGAGTTGGCAGAGTTGTATTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009387.1-727s1c1
Sequence:CCGGCCGCCTGTGCTACTTTAAGAACTCGAGTTCTTAAAGTAGCACAGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009387.1-322s1c1
Sequence:CCGGCCTGGTCATCAAGTATGCCAACTCGAGTTGGCATACTTGATGACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009387
VALIDATED
TK1 MISSION shRNA Lentiviral Transduction Particles
thymidine kinase 1, soluble
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009387.2-832s21c1
Sequence:CCGGCTCAGACAACAAGAACTGTCTCTCGAGAGACAGTTCTTGTTGTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322049    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009387.2-1014s21c1
Sequence:CCGGATGGACAATGTACCTTGAACACTCGAGTGTTCAAGGTACATTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009387.2-1003s21c1
Sequence:CCGGTGCCATTCCTAATGGACAATGCTCGAGCATTGTCCATTAGGAATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009387.2-790s21c1
Sequence:CCGGCCGCCTGTGCTACTTTAAGAACTCGAGTTCTTAAAGTAGCACAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009387.2-900s21c1
Sequence:CCGGCCTCTCAGCAAGTCCTACAATCTCGAGATTGTAGGACTTGCTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009387.1-837s1c1
Sequence:CCGGCCTCTCAGCAAGTCCTACAATCTCGAGATTGTAGGACTTGCTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009387.1-769s1c1
Sequence:CCGGCTCAGACAACAAGAACTGTCTCTCGAGAGACAGTTCTTGTTGTCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009387.1-850s1c1
Sequence:CCGGCCTACAATACAACTCTGCCAACTCGAGTTGGCAGAGTTGTATTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009387.1-727s1c1
Sequence:CCGGCCGCCTGTGCTACTTTAAGAACTCGAGTTCTTAAAGTAGCACAGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009387.1-322s1c1
Sequence:CCGGCCTGGTCATCAAGTATGCCAACTCGAGTTGGCATACTTGATGACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks