EMAIL THIS PAGE TO A FRIEND

TK2

thymidine kinase 2, mitochondrial

Synonyms: MTDPS2 MTTK
UniProtKB ID: O00142, B4DGJ7, B7ZAB1, E9PH08, O15238
Gene ID:
Human(7084) Summary: This gene encodes a deoxyribonucleoside kinase that specifically phosphorylates thymidine, deoxycytidine, and deoxyuridine. The encoded enzyme localizes to the mitochondria and is required for mitochondrial DNA synthesis. Mutations in this gene are associated with a myopathic form of mitochondrial DNA depletion syndrome. Alternate splicing results in multiple transcript variants encoding distinct isoforms, some of which lack transit peptide, so are not localized to mitochondria. [provided by RefSeq, Dec 2012]
Mouse(57813) thymidine kinase 2, mitochondrial
Rat(291824) thymidine kinase 2, mitochondrial
Zebrafish(437016) thymidine kinase 2, mitochondrial
domestic cat(101085008) thymidine kinase 2, mitochondrial
Horse(100065312) thymidine kinase 2, mitochondrial
dog(611387) thymidine kinase 2, mitochondrial
chicken(427551) thymidine kinase 2, mitochondrial
naked mole-rat(101704299) thymidine kinase 2, mitochondrial
domestic guinea pig(100727406) thymidine kinase 2, mitochondrial
cow(615457) thymidine kinase 2, mitochondrial
sheep(101103665) thymidine kinase 2, mitochondrial
113 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
361275 3′-Deoxy-3′-fluorothymidine 97% human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021028 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021028 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021028 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004614 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004614 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004614 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004614 Rosetta Predictions human pricing
NM_001106166 Rosetta Predictions rat pricing
NM_021028 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114042 predicted 820
2 SASI_Hs01_00114043 predicted 666
3 SASI_Hs01_00114044 predicted 896
4 SASI_Hs01_00114045 predicted 1198
5 SASI_Hs01_00114046 predicted 967
6 SASI_Hs02_00338006 predicted 1073
7 SASI_Hs01_00114047 predicted 497
8 SASI_Hs01_00114048 predicted 752
9 SASI_Hs02_00338007 predicted 518
10 SASI_Hs01_00114049 predicted 871
11 SASI_Hs01_00114050 predicted 1156
12 SASI_Hs01_00114051 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106166 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216278 predicted 500
2 SASI_Rn02_00216279 predicted 294
3 SASI_Rn02_00216280 predicted 753
4 SASI_Rn02_00216281 predicted 650
5 SASI_Rn02_00216282 predicted 431
6 SASI_Rn02_00216283 predicted 238
7 SASI_Rn02_00216284 predicted 639
8 SASI_Rn02_00216285 predicted 286
9 SASI_Rn02_00216286 predicted 547
10 SASI_Rn02_00216287 predicted 642
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021028 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105263 predicted 746
2 SASI_Mm01_00105264 predicted 902
3 SASI_Mm01_00105265 predicted 213
4 SASI_Mm01_00105266 predicted 420
5 SASI_Mm01_00105267 predicted 612
6 SASI_Mm01_00105268 predicted 899
7 SASI_Mm01_00105269 predicted 274
8 SASI_Mm01_00105270 predicted 627
9 SASI_Mm01_00105271 predicted 464
10 SASI_Mm01_00105272 predicted 229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021028
VALIDATED
TK2 MISSION shRNA Bacterial Glycerol Stock
thymidine kinase 2, mitochondrial
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021028.2-777s1c1
Sequence:CCGGCCGGATATTAACTCCAGAGAACTCGAGTTCTCTGGAGTTAATATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021028.2-262s1c1
Sequence:CCGGCCTGTGCTCAAGTGGAGAAATCTCGAGATTTCTCCACTTGAGCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021028.2-727s1c1
Sequence:CCGGGCTGACCACAACTTGGAGAAACTCGAGTTTCTCCAAGTTGTGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021028.2-406s1c1
Sequence:CCGGCGGTTGATGGAAAGGTCAATTCTCGAGAATTGACCTTTCCATCAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021028.3-430s21c1
Sequence:CCGGGTTGATGGAAAGGTCAATTTACTCGAGTAAATTGACCTTTCCATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021028.3-583s21c1
Sequence:CCGGTCTGCGAACCACTCCCGAAATCTCGAGATTTCGGGAGTGGTTCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361811    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021028.3-923s21c1
Sequence:CCGGTAGGAGGGTCTGTTATCTAATCTCGAGATTAGATAACAGACCCTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021028
VALIDATED
TK2 MISSION shRNA shRNA Plasmid DNA
thymidine kinase 2, mitochondrial
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021028.2-777s1c1
Sequence:CCGGCCGGATATTAACTCCAGAGAACTCGAGTTCTCTGGAGTTAATATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021028.2-262s1c1
Sequence:CCGGCCTGTGCTCAAGTGGAGAAATCTCGAGATTTCTCCACTTGAGCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021028.2-727s1c1
Sequence:CCGGGCTGACCACAACTTGGAGAAACTCGAGTTTCTCCAAGTTGTGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021028.2-406s1c1
Sequence:CCGGCGGTTGATGGAAAGGTCAATTCTCGAGAATTGACCTTTCCATCAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021028.3-430s21c1
Sequence:CCGGGTTGATGGAAAGGTCAATTTACTCGAGTAAATTGACCTTTCCATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021028.3-583s21c1
Sequence:CCGGTCTGCGAACCACTCCCGAAATCTCGAGATTTCGGGAGTGGTTCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361811    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021028.3-923s21c1
Sequence:CCGGTAGGAGGGTCTGTTATCTAATCTCGAGATTAGATAACAGACCCTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021028
VALIDATED
TK2 MISSION shRNA Lentiviral Transduction Particles
thymidine kinase 2, mitochondrial
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021028.2-777s1c1
Sequence:CCGGCCGGATATTAACTCCAGAGAACTCGAGTTCTCTGGAGTTAATATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021028.2-262s1c1
Sequence:CCGGCCTGTGCTCAAGTGGAGAAATCTCGAGATTTCTCCACTTGAGCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021028.2-727s1c1
Sequence:CCGGGCTGACCACAACTTGGAGAAACTCGAGTTTCTCCAAGTTGTGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021028.2-406s1c1
Sequence:CCGGCGGTTGATGGAAAGGTCAATTCTCGAGAATTGACCTTTCCATCAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021028.3-430s21c1
Sequence:CCGGGTTGATGGAAAGGTCAATTTACTCGAGTAAATTGACCTTTCCATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021028.3-583s21c1
Sequence:CCGGTCTGCGAACCACTCCCGAAATCTCGAGATTTCGGGAGTGGTTCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361811    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021028.3-923s21c1
Sequence:CCGGTAGGAGGGTCTGTTATCTAATCTCGAGATTAGATAACAGACCCTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004614
VALIDATED
TK2 MISSION shRNA Bacterial Glycerol Stock
thymidine kinase 2, mitochondrial
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004614.2-910s1c1
Sequence:CCGGGAGACTTGTTACCAGAGGTTACTCGAGTAACCTCTGGTAACAAGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004614.2-1883s1c1
Sequence:CCGGCCACATCTTCATGTGGACATTCTCGAGAATGTCCACATGAAGATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004614.2-789s1c1
Sequence:CCGGCCTGTATAGAAGTGGGAAGATCTCGAGATCTTCCCACTTCTATACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004614.2-595s1c1
Sequence:CCGGCCTGTGTCCAAGTGGAGAAATCTCGAGATTTCTCCACTTGGACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004614.3-568s1c1
Sequence:CCGGGCGACAGACGTCGAGGTGTTACTCGAGTAACACCTCGACGTCTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197174    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004614.3-2494s1c1
Sequence:CCGGGCTGTAAATAGAGGTAGCAAGCTCGAGCTTGCTACCTCTATTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004614.3-910s21c1
Sequence:CCGGGAGACTTGTTACCAGAGGTTACTCGAGTAACCTCTGGTAACAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004614.3-595s21c1
Sequence:CCGGCCTGTGTCCAAGTGGAGAAATCTCGAGATTTCTCCACTTGGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004614.3-789s21c1
Sequence:CCGGCCTGTATAGAAGTGGGAAGATCTCGAGATCTTCCCACTTCTATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004614.3-568s21c1
Sequence:CCGGGCGACAGACGTCGAGGTGTTACTCGAGTAACACCTCGACGTCTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004614.3-873s1c1
Sequence:CCGGGTCTGTTGATTTGATAGTTTACTCGAGTAAACTATCAAATCAACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004614.3-754s1c1
Sequence:CCGGTCGATTCACAGCGCAAGATACCTCGAGGTATCTTGCGCTGTGAATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004614.3-508s1c1
Sequence:CCGGATCTGTGTCGAGGGCAATATTCTCGAGAATATTGCCCTCGACACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004614
VALIDATED
TK2 MISSION shRNA shRNA Plasmid DNA
thymidine kinase 2, mitochondrial
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004614.2-910s1c1
Sequence:CCGGGAGACTTGTTACCAGAGGTTACTCGAGTAACCTCTGGTAACAAGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004614.2-1883s1c1
Sequence:CCGGCCACATCTTCATGTGGACATTCTCGAGAATGTCCACATGAAGATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004614.2-789s1c1
Sequence:CCGGCCTGTATAGAAGTGGGAAGATCTCGAGATCTTCCCACTTCTATACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004614.2-595s1c1
Sequence:CCGGCCTGTGTCCAAGTGGAGAAATCTCGAGATTTCTCCACTTGGACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004614.3-568s1c1
Sequence:CCGGGCGACAGACGTCGAGGTGTTACTCGAGTAACACCTCGACGTCTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197174    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004614.3-2494s1c1
Sequence:CCGGGCTGTAAATAGAGGTAGCAAGCTCGAGCTTGCTACCTCTATTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004614.3-910s21c1
Sequence:CCGGGAGACTTGTTACCAGAGGTTACTCGAGTAACCTCTGGTAACAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004614.3-595s21c1
Sequence:CCGGCCTGTGTCCAAGTGGAGAAATCTCGAGATTTCTCCACTTGGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004614.3-789s21c1
Sequence:CCGGCCTGTATAGAAGTGGGAAGATCTCGAGATCTTCCCACTTCTATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004614.3-568s21c1
Sequence:CCGGGCGACAGACGTCGAGGTGTTACTCGAGTAACACCTCGACGTCTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004614.3-873s1c1
Sequence:CCGGGTCTGTTGATTTGATAGTTTACTCGAGTAAACTATCAAATCAACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004614.3-754s1c1
Sequence:CCGGTCGATTCACAGCGCAAGATACCTCGAGGTATCTTGCGCTGTGAATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004614.3-508s1c1
Sequence:CCGGATCTGTGTCGAGGGCAATATTCTCGAGAATATTGCCCTCGACACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004614
VALIDATED
TK2 MISSION shRNA Lentiviral Transduction Particles
thymidine kinase 2, mitochondrial
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004614.2-910s1c1
Sequence:CCGGGAGACTTGTTACCAGAGGTTACTCGAGTAACCTCTGGTAACAAGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004614.2-1883s1c1
Sequence:CCGGCCACATCTTCATGTGGACATTCTCGAGAATGTCCACATGAAGATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004614.2-789s1c1
Sequence:CCGGCCTGTATAGAAGTGGGAAGATCTCGAGATCTTCCCACTTCTATACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004614.2-595s1c1
Sequence:CCGGCCTGTGTCCAAGTGGAGAAATCTCGAGATTTCTCCACTTGGACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004614.3-568s1c1
Sequence:CCGGGCGACAGACGTCGAGGTGTTACTCGAGTAACACCTCGACGTCTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197174    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004614.3-2494s1c1
Sequence:CCGGGCTGTAAATAGAGGTAGCAAGCTCGAGCTTGCTACCTCTATTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004614.3-910s21c1
Sequence:CCGGGAGACTTGTTACCAGAGGTTACTCGAGTAACCTCTGGTAACAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004614.3-595s21c1
Sequence:CCGGCCTGTGTCCAAGTGGAGAAATCTCGAGATTTCTCCACTTGGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004614.3-789s21c1
Sequence:CCGGCCTGTATAGAAGTGGGAAGATCTCGAGATCTTCCCACTTCTATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004614.3-568s21c1
Sequence:CCGGGCGACAGACGTCGAGGTGTTACTCGAGTAACACCTCGACGTCTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004614.3-873s1c1
Sequence:CCGGGTCTGTTGATTTGATAGTTTACTCGAGTAAACTATCAAATCAACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004614.3-754s1c1
Sequence:CCGGTCGATTCACAGCGCAAGATACCTCGAGGTATCTTGCGCTGTGAATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004614.3-508s1c1
Sequence:CCGGATCTGTGTCGAGGGCAATATTCTCGAGAATATTGCCCTCGACACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks