EMAIL THIS PAGE TO A FRIEND

TKT

transketolase

Synonyms: TK TKT1
UniProtKB ID: P29401, A8K089, B4DE31, E7EPA7, Q8TBA3, Q96HH3
Gene ID:
Human(7086) Summary: This gene encodes a thiamine-dependent enzyme which plays a role in the channeling of excess sugar phosphates to glycolysis in the pentose phosphate pathway. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2012]
Mouse(21881) transketolase
Rat(64524) transketolase
cow(445425) transketolase
sheep(101107229) transketolase
chicken(415991) transketolase
dog(476588) transketolase
domestic cat(101093922) transketolase
Horse(100034031) transketolase
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001064 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001064 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001064 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009388 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009388 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009388 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001064 siRNAs that have been validated in the lab human pricing
NM_022592 Rosetta Predictions rat pricing
NM_009388 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001064 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241971 validated 1495
1 SASI_Hs01_00241973 validated 1276
1 SASI_Hs01_00241972 validated 530
2 SASI_Hs01_00241974 predicted 1133
3 SASI_Hs01_00241975 predicted 1031
4 SASI_Hs02_00311870 predicted 1337
5 SASI_Hs01_00241976 predicted 1106
6 SASI_Hs01_00241977 predicted 933
7 SASI_Hs01_00241978 predicted 1367
8 SASI_Hs01_00241979 predicted 398
9 SASI_Hs01_00241980 predicted 1391
10 SASI_Hs02_00311871 predicted 1207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022592 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110931 predicted 1683
2 SASI_Rn01_00110932 predicted 1181
3 SASI_Rn01_00110934 predicted 1815
4 SASI_Rn01_00110935 predicted 1477
5 SASI_Rn01_00110936 predicted 1147
6 SASI_Rn01_00110937 predicted 912
7 SASI_Rn02_00263337 predicted 1740
8 SASI_Rn01_00110938 predicted 1478
9 SASI_Rn01_00110939 predicted 1477
10 SASI_Rn01_00110940 predicted 914
11 SASI_Rn01_00110933 predicted 1199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009388 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187218 predicted 1515
2 SASI_Mm01_00187220 predicted 922
3 SASI_Mm01_00187221 predicted 1492
4 SASI_Mm01_00187222 predicted 755
5 SASI_Mm01_00187223 predicted 1555
6 SASI_Mm01_00187224 predicted 849
7 SASI_Mm01_00187225 predicted 1057
8 SASI_Mm01_00187226 predicted 459
9 SASI_Mm01_00187227 predicted 1009
10 SASI_Mm02_00316002 predicted 1808
11 SASI_Mm01_00187219 predicted 534
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001064
VALIDATED
TKT MISSION shRNA Bacterial Glycerol Stock
transketolase
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001064.2-1608s21c1
Sequence:CCGGGATGACCAGGTGACCGTTATCCTCGAGGATAACGGTCACCTGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001064.2-1402s21c1
Sequence:CCGGTAGAAGATCTGGCTATGTTTCCTCGAGGAAACATAGCCAGATCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001064.2-1542s21c1
Sequence:CCGGGCCATCATCTATAACAACAATCTCGAGATTGTTGTTATAGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001064.2-1905s21c1
Sequence:CCGGGCTGAGCTGCTGAAGATGTTTCTCGAGAAACATCTTCAGCAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_001064.2-1780s21c1
Sequence:CCGGTCACCGTGGAGGACCATTATTCTCGAGAATAATGGTCCTCCACGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001064.2-1479s21c1
Sequence:CCGGGCAGTGGAACTAGCCGCCAATCTCGAGATTGGCGGCTAGTTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001064.1-1432s1c1
Sequence:CCGGGCCATCATCTATAACAACAATCTCGAGATTGTTGTTATAGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001064.1-1369s1c1
Sequence:CCGGGCAGTGGAACTAGCCGCCAATCTCGAGATTGGCGGCTAGTTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001064.1-510s1c1
Sequence:CCGGCAGCATCTATAAGCTGGACAACTCGAGTTGTCCAGCTTATAGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001064.1-411s1c1
Sequence:CCGGCACCGGCAAATACTTCGACAACTCGAGTTGTCGAAGTATTTGCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001064.1-1795s1c1
Sequence:CCGGGCTGAGCTGCTGAAGATGTTTCTCGAGAAACATCTTCAGCAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001064
VALIDATED
TKT MISSION shRNA shRNA Plasmid DNA
transketolase
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001064.2-1608s21c1
Sequence:CCGGGATGACCAGGTGACCGTTATCCTCGAGGATAACGGTCACCTGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001064.2-1402s21c1
Sequence:CCGGTAGAAGATCTGGCTATGTTTCCTCGAGGAAACATAGCCAGATCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001064.2-1542s21c1
Sequence:CCGGGCCATCATCTATAACAACAATCTCGAGATTGTTGTTATAGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001064.2-1905s21c1
Sequence:CCGGGCTGAGCTGCTGAAGATGTTTCTCGAGAAACATCTTCAGCAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_001064.2-1780s21c1
Sequence:CCGGTCACCGTGGAGGACCATTATTCTCGAGAATAATGGTCCTCCACGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001064.2-1479s21c1
Sequence:CCGGGCAGTGGAACTAGCCGCCAATCTCGAGATTGGCGGCTAGTTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001064.1-1432s1c1
Sequence:CCGGGCCATCATCTATAACAACAATCTCGAGATTGTTGTTATAGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001064.1-1369s1c1
Sequence:CCGGGCAGTGGAACTAGCCGCCAATCTCGAGATTGGCGGCTAGTTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001064.1-510s1c1
Sequence:CCGGCAGCATCTATAAGCTGGACAACTCGAGTTGTCCAGCTTATAGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001064.1-411s1c1
Sequence:CCGGCACCGGCAAATACTTCGACAACTCGAGTTGTCGAAGTATTTGCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001064.1-1795s1c1
Sequence:CCGGGCTGAGCTGCTGAAGATGTTTCTCGAGAAACATCTTCAGCAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001064
VALIDATED
TKT MISSION shRNA Lentiviral Transduction Particles
transketolase
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001064.2-1608s21c1
Sequence:CCGGGATGACCAGGTGACCGTTATCCTCGAGGATAACGGTCACCTGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001064.2-1402s21c1
Sequence:CCGGTAGAAGATCTGGCTATGTTTCCTCGAGGAAACATAGCCAGATCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001064.2-1542s21c1
Sequence:CCGGGCCATCATCTATAACAACAATCTCGAGATTGTTGTTATAGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001064.2-1905s21c1
Sequence:CCGGGCTGAGCTGCTGAAGATGTTTCTCGAGAAACATCTTCAGCAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_001064.2-1780s21c1
Sequence:CCGGTCACCGTGGAGGACCATTATTCTCGAGAATAATGGTCCTCCACGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001064.2-1479s21c1
Sequence:CCGGGCAGTGGAACTAGCCGCCAATCTCGAGATTGGCGGCTAGTTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001064.1-1432s1c1
Sequence:CCGGGCCATCATCTATAACAACAATCTCGAGATTGTTGTTATAGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001064.1-1369s1c1
Sequence:CCGGGCAGTGGAACTAGCCGCCAATCTCGAGATTGGCGGCTAGTTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001064.1-510s1c1
Sequence:CCGGCAGCATCTATAAGCTGGACAACTCGAGTTGTCCAGCTTATAGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001064.1-411s1c1
Sequence:CCGGCACCGGCAAATACTTCGACAACTCGAGTTGTCGAAGTATTTGCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001064.1-1795s1c1
Sequence:CCGGGCTGAGCTGCTGAAGATGTTTCTCGAGAAACATCTTCAGCAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009388
TKT MISSION shRNA Bacterial Glycerol Stock
transketolase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009388.5-1197s21c1
Sequence:CCGGCGGTTCATTGAGTGCTACATTCTCGAGAATGTAGCACTCAATGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009388.5-1546s21c1
Sequence:CCGGGCCCAGAGAATGCCATTATTTCTCGAGAAATAATGGCATTCTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009388.5-1925s21c1
Sequence:CCGGGCTACTGAAGATGTTCGGTATCTCGAGATACCGAACATCTTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009388.5-3043s21c1
Sequence:CCGGCCTTACTACAAGAAACCACTTCTCGAGAAGTGGTTTCTTGTAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009388.5-527s21c1
Sequence:CCGGGATGGCATACACAGGCAAATACTCGAGTATTTGCCTGTGTATGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009388.2-3043s1c1
Sequence:CCGGCCTTACTACAAGAAACCACTTCTCGAGAAGTGGTTTCTTGTAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009388.2-1547s1c1
Sequence:CCGGGCCCAGAGAATGCCATTATTTCTCGAGAAATAATGGCATTCTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009388.2-1926s1c1
Sequence:CCGGGCTACTGAAGATGTTCGGTATCTCGAGATACCGAACATCTTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009388.2-1198s1c1
Sequence:CCGGCGGTTCATTGAGTGCTACATTCTCGAGAATGTAGCACTCAATGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009388.2-528s1c1
Sequence:CCGGGATGGCATACACAGGCAAATACTCGAGTATTTGCCTGTGTATGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009388
TKT MISSION shRNA shRNA Plasmid DNA
transketolase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009388.5-1197s21c1
Sequence:CCGGCGGTTCATTGAGTGCTACATTCTCGAGAATGTAGCACTCAATGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009388.5-1546s21c1
Sequence:CCGGGCCCAGAGAATGCCATTATTTCTCGAGAAATAATGGCATTCTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009388.5-1925s21c1
Sequence:CCGGGCTACTGAAGATGTTCGGTATCTCGAGATACCGAACATCTTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009388.5-3043s21c1
Sequence:CCGGCCTTACTACAAGAAACCACTTCTCGAGAAGTGGTTTCTTGTAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009388.5-527s21c1
Sequence:CCGGGATGGCATACACAGGCAAATACTCGAGTATTTGCCTGTGTATGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009388.2-3043s1c1
Sequence:CCGGCCTTACTACAAGAAACCACTTCTCGAGAAGTGGTTTCTTGTAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009388.2-1547s1c1
Sequence:CCGGGCCCAGAGAATGCCATTATTTCTCGAGAAATAATGGCATTCTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009388.2-1926s1c1
Sequence:CCGGGCTACTGAAGATGTTCGGTATCTCGAGATACCGAACATCTTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009388.2-1198s1c1
Sequence:CCGGCGGTTCATTGAGTGCTACATTCTCGAGAATGTAGCACTCAATGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009388.2-528s1c1
Sequence:CCGGGATGGCATACACAGGCAAATACTCGAGTATTTGCCTGTGTATGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009388
TKT MISSION shRNA Lentiviral Transduction Particles
transketolase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009388.5-1197s21c1
Sequence:CCGGCGGTTCATTGAGTGCTACATTCTCGAGAATGTAGCACTCAATGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009388.5-1546s21c1
Sequence:CCGGGCCCAGAGAATGCCATTATTTCTCGAGAAATAATGGCATTCTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009388.5-1925s21c1
Sequence:CCGGGCTACTGAAGATGTTCGGTATCTCGAGATACCGAACATCTTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009388.5-3043s21c1
Sequence:CCGGCCTTACTACAAGAAACCACTTCTCGAGAAGTGGTTTCTTGTAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009388.5-527s21c1
Sequence:CCGGGATGGCATACACAGGCAAATACTCGAGTATTTGCCTGTGTATGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009388.2-3043s1c1
Sequence:CCGGCCTTACTACAAGAAACCACTTCTCGAGAAGTGGTTTCTTGTAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009388.2-1547s1c1
Sequence:CCGGGCCCAGAGAATGCCATTATTTCTCGAGAAATAATGGCATTCTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009388.2-1926s1c1
Sequence:CCGGGCTACTGAAGATGTTCGGTATCTCGAGATACCGAACATCTTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009388.2-1198s1c1
Sequence:CCGGCGGTTCATTGAGTGCTACATTCTCGAGAATGTAGCACTCAATGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009388.2-528s1c1
Sequence:CCGGGATGGCATACACAGGCAAATACTCGAGTATTTGCCTGTGTATGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks