EMAIL THIS PAGE TO A FRIEND

TKTL1

transketolase-like 1

Synonyms: TKR TKT2
UniProtKB ID: P51854, A8K896, Q5TYJ9, Q8TC75
Gene ID:
Human(8277) Summary: The protein encoded by this gene is a transketolase that acts as a homodimer and catalyzes the conversion of sedoheptulose 7-phosphate and D-glyceraldehyde 3-phosphate to D-ribose 5-phosphate and D-xylulose 5-phosphate. This reaction links the pentose phosphate pathway with the glycolytic pathway. Variations in this gene may be the cause of Wernicke-Korsakoff syndrome. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
Mouse(83553) transketolase-like 1
Rat(689374) transketolase-like 1
domestic cat(101091266) transketolase-like 1
dog(481083) transketolase-like 1
naked mole-rat(101715483) transketolase-like 1
Domestic Rabbit(100354239) transketolase-like 1
domestic guinea pig(100725793) transketolase-like 1
cow(507517) transketolase-like 1
sheep(101109516) transketolase-like 1
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012253 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012253 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012253 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031379 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031379 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031379 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012253 Rosetta Predictions human pricing
NM_001109534 Rosetta Predictions rat pricing
NM_031379 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012253 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222947 predicted 315
2 SASI_Hs01_00222948 predicted 755
3 SASI_Hs01_00222949 predicted 647
4 SASI_Hs01_00222950 predicted 1481
5 SASI_Hs01_00222951 predicted 222
6 SASI_Hs01_00222953 predicted 932
7 SASI_Hs01_00222954 predicted 865
8 SASI_Hs01_00222955 predicted 1814
9 SASI_Hs01_00222956 predicted 510
10 SASI_Hs02_00343962 predicted 954
11 SASI_Hs01_00222952 predicted 385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109534 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249349 predicted 1021
2 SASI_Rn02_00249350 predicted 314
3 SASI_Rn02_00249351 predicted 1866
4 SASI_Rn02_00249352 predicted 1774
5 SASI_Rn02_00249353 predicted 1713
6 SASI_Rn02_00249354 predicted 858
7 SASI_Rn02_00249355 predicted 1169
8 SASI_Rn02_00249356 predicted 888
9 SASI_Rn02_00249357 predicted 216
10 SASI_Rn02_00249358 predicted 1352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031379 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131133 predicted 886
2 SASI_Mm01_00131134 predicted 1016
3 SASI_Mm01_00131135 predicted 1684
4 SASI_Mm01_00131136 predicted 809
5 SASI_Mm01_00131137 predicted 1799
6 SASI_Mm01_00131138 predicted 1203
7 SASI_Mm01_00131139 predicted 717
8 SASI_Mm01_00131140 predicted 1439
9 SASI_Mm01_00131141 predicted 1303
10 SASI_Mm01_00131142 predicted 1129
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012253
VALIDATED
TKTL1 MISSION shRNA Bacterial Glycerol Stock
transketolase-like 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_012253.1-1293s1c1
Sequence:CCGGCCGACCAGAAACTATGGTTATCTCGAGATAACCATAGTTTCTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_012253.1-906s1c1
Sequence:CCGGCTCTACTTTCTCTGAGATATTCTCGAGAATATCTCAGAGAAAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012253.1-391s1c1
Sequence:CCGGGACAATCTTGTGGCAATCTTTCTCGAGAAAGATTGCCACAAGATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_012253.1-1447s1c1
Sequence:CCGGGCTGGAATTACTGTGTATGAACTCGAGTTCATACACAGTAATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012253.1-1588s1c1
Sequence:CCGGCGGATCATTACAGTGGAGGATCTCGAGATCCTCCACTGTAATGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012253.3-407s21c1
Sequence:CCGGATCCGGACAACGACCGATTTGCTCGAGCAAATCGGTCGTTGTCCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012253.3-2298s21c1
Sequence:CCGGGAAGTGTTTCCTTCGTGAATACTCGAGTATTCACGAAGGAAACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012253.3-2100s21c1
Sequence:CCGGTTCATCCCTAGTTCGGAAATTCTCGAGAATTTCCGAACTAGGGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012253.3-1607s21c1
Sequence:CCGGGTGACAAGGTCACAGTTATTGCTCGAGCAATAACTGTGACCTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012253.3-1670s21c1
Sequence:CCGGAGCTTTCGAAACAAGATATTTCTCGAGAAATATCTTGTTTCGAAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012253.3-2155s21c1
Sequence:CCGGATATGCAAGTACCGCTCTAATCTCGAGATTAGAGCGGTACTTGCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012253.3-490s21c1
Sequence:CCGGGTTGCATGTGGAATGGCATATCTCGAGATATGCCATTCCACATGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012253.3-1891s21c1
Sequence:CCGGAGTGGGAAGTCCGAGGAATTGCTCGAGCAATTCCTCGGACTTCCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012253
VALIDATED
TKTL1 MISSION shRNA shRNA Plasmid DNA
transketolase-like 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_012253.1-1293s1c1
Sequence:CCGGCCGACCAGAAACTATGGTTATCTCGAGATAACCATAGTTTCTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_012253.1-906s1c1
Sequence:CCGGCTCTACTTTCTCTGAGATATTCTCGAGAATATCTCAGAGAAAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012253.1-391s1c1
Sequence:CCGGGACAATCTTGTGGCAATCTTTCTCGAGAAAGATTGCCACAAGATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_012253.1-1447s1c1
Sequence:CCGGGCTGGAATTACTGTGTATGAACTCGAGTTCATACACAGTAATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012253.1-1588s1c1
Sequence:CCGGCGGATCATTACAGTGGAGGATCTCGAGATCCTCCACTGTAATGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012253.3-407s21c1
Sequence:CCGGATCCGGACAACGACCGATTTGCTCGAGCAAATCGGTCGTTGTCCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012253.3-2298s21c1
Sequence:CCGGGAAGTGTTTCCTTCGTGAATACTCGAGTATTCACGAAGGAAACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012253.3-2100s21c1
Sequence:CCGGTTCATCCCTAGTTCGGAAATTCTCGAGAATTTCCGAACTAGGGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012253.3-1607s21c1
Sequence:CCGGGTGACAAGGTCACAGTTATTGCTCGAGCAATAACTGTGACCTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012253.3-1670s21c1
Sequence:CCGGAGCTTTCGAAACAAGATATTTCTCGAGAAATATCTTGTTTCGAAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012253.3-2155s21c1
Sequence:CCGGATATGCAAGTACCGCTCTAATCTCGAGATTAGAGCGGTACTTGCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012253.3-490s21c1
Sequence:CCGGGTTGCATGTGGAATGGCATATCTCGAGATATGCCATTCCACATGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012253.3-1891s21c1
Sequence:CCGGAGTGGGAAGTCCGAGGAATTGCTCGAGCAATTCCTCGGACTTCCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012253
VALIDATED
TKTL1 MISSION shRNA Lentiviral Transduction Particles
transketolase-like 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_012253.1-1293s1c1
Sequence:CCGGCCGACCAGAAACTATGGTTATCTCGAGATAACCATAGTTTCTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_012253.1-906s1c1
Sequence:CCGGCTCTACTTTCTCTGAGATATTCTCGAGAATATCTCAGAGAAAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012253.1-391s1c1
Sequence:CCGGGACAATCTTGTGGCAATCTTTCTCGAGAAAGATTGCCACAAGATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_012253.1-1447s1c1
Sequence:CCGGGCTGGAATTACTGTGTATGAACTCGAGTTCATACACAGTAATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012253.1-1588s1c1
Sequence:CCGGCGGATCATTACAGTGGAGGATCTCGAGATCCTCCACTGTAATGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012253.3-407s21c1
Sequence:CCGGATCCGGACAACGACCGATTTGCTCGAGCAAATCGGTCGTTGTCCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012253.3-2298s21c1
Sequence:CCGGGAAGTGTTTCCTTCGTGAATACTCGAGTATTCACGAAGGAAACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012253.3-2100s21c1
Sequence:CCGGTTCATCCCTAGTTCGGAAATTCTCGAGAATTTCCGAACTAGGGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012253.3-1607s21c1
Sequence:CCGGGTGACAAGGTCACAGTTATTGCTCGAGCAATAACTGTGACCTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012253.3-1670s21c1
Sequence:CCGGAGCTTTCGAAACAAGATATTTCTCGAGAAATATCTTGTTTCGAAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012253.3-2155s21c1
Sequence:CCGGATATGCAAGTACCGCTCTAATCTCGAGATTAGAGCGGTACTTGCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012253.3-490s21c1
Sequence:CCGGGTTGCATGTGGAATGGCATATCTCGAGATATGCCATTCCACATGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012253.3-1891s21c1
Sequence:CCGGAGTGGGAAGTCCGAGGAATTGCTCGAGCAATTCCTCGGACTTCCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031379
TKTL1 MISSION shRNA Bacterial Glycerol Stock
transketolase-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031379.1-1357s1c1
Sequence:CCGGGCAATTATTTACACCACTCAACTCGAGTTGAGTGGTGTAAATAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031379.1-418s1c1
Sequence:CCGGGCCTTTGCATCCTACTACAATCTCGAGATTGTAGTAGGATGCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031379.1-1660s1c1
Sequence:CCGGGAGCCTAACATTGTGGTTCATCTCGAGATGAACCACAATGTTAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031379.1-2023s1c1
Sequence:CCGGGCAGAATAGATAACAAGACAACTCGAGTTGTCTTGTTATCTATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031379.1-801s1c1
Sequence:CCGGCTCGCCTCAAATTAACATCATCTCGAGATGATGTTAATTTGAGGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031379.1-1662s1c1
Sequence:CCGGGCCTAACATTGTGGTTCATAACTCGAGTTATGAACCACAATGTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031379.1-1554s1c1
Sequence:CCGGCACCATCATTTCCAATGCAAACTCGAGTTTGCATTGGAAATGATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031379.2-1447s1c1
Sequence:CCGGCAATGACAAGGTCATAGTTATCTCGAGATAACTATGACCTTGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031379.2-1543s1c1
Sequence:CCGGCATTGACTTGTTTACCATTAACTCGAGTTAATGGTAAACAAGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216274    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031379.2-1981s1c1
Sequence:CCGGCTAATCTGTGACTACACATACCTCGAGGTATGTGTAGTCACAGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031379
TKTL1 MISSION shRNA shRNA Plasmid DNA
transketolase-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031379.1-1357s1c1
Sequence:CCGGGCAATTATTTACACCACTCAACTCGAGTTGAGTGGTGTAAATAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031379.1-418s1c1
Sequence:CCGGGCCTTTGCATCCTACTACAATCTCGAGATTGTAGTAGGATGCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031379.1-1660s1c1
Sequence:CCGGGAGCCTAACATTGTGGTTCATCTCGAGATGAACCACAATGTTAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031379.1-2023s1c1
Sequence:CCGGGCAGAATAGATAACAAGACAACTCGAGTTGTCTTGTTATCTATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031379.1-801s1c1
Sequence:CCGGCTCGCCTCAAATTAACATCATCTCGAGATGATGTTAATTTGAGGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031379.1-1662s1c1
Sequence:CCGGGCCTAACATTGTGGTTCATAACTCGAGTTATGAACCACAATGTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031379.1-1554s1c1
Sequence:CCGGCACCATCATTTCCAATGCAAACTCGAGTTTGCATTGGAAATGATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031379.2-1447s1c1
Sequence:CCGGCAATGACAAGGTCATAGTTATCTCGAGATAACTATGACCTTGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031379.2-1543s1c1
Sequence:CCGGCATTGACTTGTTTACCATTAACTCGAGTTAATGGTAAACAAGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216274    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031379.2-1981s1c1
Sequence:CCGGCTAATCTGTGACTACACATACCTCGAGGTATGTGTAGTCACAGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031379
TKTL1 MISSION shRNA Lentiviral Transduction Particles
transketolase-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031379.1-1357s1c1
Sequence:CCGGGCAATTATTTACACCACTCAACTCGAGTTGAGTGGTGTAAATAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031379.1-418s1c1
Sequence:CCGGGCCTTTGCATCCTACTACAATCTCGAGATTGTAGTAGGATGCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031379.1-1660s1c1
Sequence:CCGGGAGCCTAACATTGTGGTTCATCTCGAGATGAACCACAATGTTAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031379.1-2023s1c1
Sequence:CCGGGCAGAATAGATAACAAGACAACTCGAGTTGTCTTGTTATCTATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031379.1-801s1c1
Sequence:CCGGCTCGCCTCAAATTAACATCATCTCGAGATGATGTTAATTTGAGGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031379.1-1662s1c1
Sequence:CCGGGCCTAACATTGTGGTTCATAACTCGAGTTATGAACCACAATGTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031379.1-1554s1c1
Sequence:CCGGCACCATCATTTCCAATGCAAACTCGAGTTTGCATTGGAAATGATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031379.2-1447s1c1
Sequence:CCGGCAATGACAAGGTCATAGTTATCTCGAGATAACTATGACCTTGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031379.2-1543s1c1
Sequence:CCGGCATTGACTTGTTTACCATTAACTCGAGTTAATGGTAAACAAGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216274    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031379.2-1981s1c1
Sequence:CCGGCTAATCTGTGACTACACATACCTCGAGGTATGTGTAGTCACAGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks