EMAIL THIS PAGE TO A FRIEND

TKTL2

transketolase-like 2

UniProtKB ID: Q9H0I9, A4FVB4, Q8NCT0, Q96M82
Gene ID:
Mouse(74419) transketolase-like 2
Rat(290685) transketolase-like 2
cow(509186) transketolase-like 2
sheep(101106590) transketolase-like 2
domestic guinea pig(100722949) transketolase-like 2
naked mole-rat(101726510) transketolase-like 2
Horse(100068531) transketolase-like 2
domestic cat(101099372) transketolase-like 2
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032136 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032136 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032136 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028927 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028927 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028927 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032136 Rosetta Predictions human pricing
NM_001106080 Rosetta Predictions rat pricing
NM_028927 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032136 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123880 predicted 1003
2 SASI_Hs01_00123881 predicted 1970
3 SASI_Hs01_00123882 predicted 866
4 SASI_Hs01_00123883 predicted 2061
5 SASI_Hs02_00359361 predicted 1533
6 SASI_Hs01_00123884 predicted 1141
7 SASI_Hs01_00123885 predicted 768
8 SASI_Hs01_00123886 predicted 805
9 SASI_Hs02_00359362 predicted 1091
10 SASI_Hs01_00123887 predicted 1279
11 SASI_Hs01_00123888 predicted 1104
12 SASI_Hs01_00123889 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106080 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215432 predicted 837
2 SASI_Rn02_00215433 predicted 1469
3 SASI_Rn02_00215434 predicted 1479
4 SASI_Rn02_00215435 predicted 1231
5 SASI_Rn02_00215436 predicted 1018
6 SASI_Rn02_00215437 predicted 1480
7 SASI_Rn02_00215438 predicted 201
8 SASI_Rn02_00215439 predicted 842
9 SASI_Rn02_00215440 predicted 968
10 SASI_Rn02_00215441 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028927 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082272 predicted 1068
2 SASI_Mm01_00082273 predicted 395
3 SASI_Mm01_00082274 predicted 1657
4 SASI_Mm01_00082275 predicted 1493
5 SASI_Mm01_00082276 predicted 1787
6 SASI_Mm01_00082277 predicted 1037
7 SASI_Mm01_00082278 predicted 1049
8 SASI_Mm01_00082279 predicted 457
9 SASI_Mm01_00082280 predicted 1246
10 SASI_Mm01_00082281 predicted 583
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032136
TKTL2 MISSION shRNA Bacterial Glycerol Stock
transketolase-like 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032136.4-2036s21c1
Sequence:CCGGGAAGTAAACTAGGCTTATTTCCTCGAGGAAATAAGCCTAGTTTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032136.4-1658s21c1
Sequence:CCGGCCGCCACGGTGTCAATGATAACTCGAGTTATCATTGACACCGTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032136.4-1528s21c1
Sequence:CCGGTCTCGACAGAGCATGCTATTTCTCGAGAAATAGCATGCTCTGTCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032136.4-1759s21c1
Sequence:CCGGTCCGTGTCATCGACCCATTTACTCGAGTAAATGGGTCGATGACACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032136.4-1149s21c1
Sequence:CCGGGCTAAACTGGGCCGTGCAAATCTCGAGATTTGCACGGCCCAGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032136.3-1956s1c1
Sequence:CCGGGCAGCCGTAACACTTACTTTACTCGAGTAAAGTAAGTGTTACGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032136.3-2033s1c1
Sequence:CCGGGCACTGGTATCTTTGTATTAACTCGAGTTAATACAAAGATACCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032136.3-1104s1c1
Sequence:CCGGCGTGCAAATGAAAGAGTTATTCTCGAGAATAACTCTTTCATTTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032136.3-1957s1c1
Sequence:CCGGCAGCCGTAACACTTACTTTAACTCGAGTTAAAGTAAGTGTTACGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158717    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032136.3-2116s1c1
Sequence:CCGGGCAAAGCCATTTAACATCTTTCTCGAGAAAGATGTTAAATGGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032136.3-1185s1c1
Sequence:CCGGGAGCGTTTCATAGAGTGTATTCTCGAGAATACACTCTATGAAACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032136.3-2581s1c1
Sequence:CCGGGTGATGAAAGTATAACTGGTTCTCGAGAACCAGTTATACTTTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032136
TKTL2 MISSION shRNA shRNA Plasmid DNA
transketolase-like 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032136.4-2036s21c1
Sequence:CCGGGAAGTAAACTAGGCTTATTTCCTCGAGGAAATAAGCCTAGTTTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032136.4-1658s21c1
Sequence:CCGGCCGCCACGGTGTCAATGATAACTCGAGTTATCATTGACACCGTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032136.4-1528s21c1
Sequence:CCGGTCTCGACAGAGCATGCTATTTCTCGAGAAATAGCATGCTCTGTCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032136.4-1759s21c1
Sequence:CCGGTCCGTGTCATCGACCCATTTACTCGAGTAAATGGGTCGATGACACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032136.4-1149s21c1
Sequence:CCGGGCTAAACTGGGCCGTGCAAATCTCGAGATTTGCACGGCCCAGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032136.3-1956s1c1
Sequence:CCGGGCAGCCGTAACACTTACTTTACTCGAGTAAAGTAAGTGTTACGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032136.3-2033s1c1
Sequence:CCGGGCACTGGTATCTTTGTATTAACTCGAGTTAATACAAAGATACCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032136.3-1104s1c1
Sequence:CCGGCGTGCAAATGAAAGAGTTATTCTCGAGAATAACTCTTTCATTTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032136.3-1957s1c1
Sequence:CCGGCAGCCGTAACACTTACTTTAACTCGAGTTAAAGTAAGTGTTACGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158717    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032136.3-2116s1c1
Sequence:CCGGGCAAAGCCATTTAACATCTTTCTCGAGAAAGATGTTAAATGGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032136.3-1185s1c1
Sequence:CCGGGAGCGTTTCATAGAGTGTATTCTCGAGAATACACTCTATGAAACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032136.3-2581s1c1
Sequence:CCGGGTGATGAAAGTATAACTGGTTCTCGAGAACCAGTTATACTTTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032136
TKTL2 MISSION shRNA Lentiviral Transduction Particles
transketolase-like 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032136.4-2036s21c1
Sequence:CCGGGAAGTAAACTAGGCTTATTTCCTCGAGGAAATAAGCCTAGTTTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032136.4-1658s21c1
Sequence:CCGGCCGCCACGGTGTCAATGATAACTCGAGTTATCATTGACACCGTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032136.4-1528s21c1
Sequence:CCGGTCTCGACAGAGCATGCTATTTCTCGAGAAATAGCATGCTCTGTCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032136.4-1759s21c1
Sequence:CCGGTCCGTGTCATCGACCCATTTACTCGAGTAAATGGGTCGATGACACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032136.4-1149s21c1
Sequence:CCGGGCTAAACTGGGCCGTGCAAATCTCGAGATTTGCACGGCCCAGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032136.3-1956s1c1
Sequence:CCGGGCAGCCGTAACACTTACTTTACTCGAGTAAAGTAAGTGTTACGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032136.3-2033s1c1
Sequence:CCGGGCACTGGTATCTTTGTATTAACTCGAGTTAATACAAAGATACCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032136.3-1104s1c1
Sequence:CCGGCGTGCAAATGAAAGAGTTATTCTCGAGAATAACTCTTTCATTTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032136.3-1957s1c1
Sequence:CCGGCAGCCGTAACACTTACTTTAACTCGAGTTAAAGTAAGTGTTACGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158717    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032136.3-2116s1c1
Sequence:CCGGGCAAAGCCATTTAACATCTTTCTCGAGAAAGATGTTAAATGGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032136.3-1185s1c1
Sequence:CCGGGAGCGTTTCATAGAGTGTATTCTCGAGAATACACTCTATGAAACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032136.3-2581s1c1
Sequence:CCGGGTGATGAAAGTATAACTGGTTCTCGAGAACCAGTTATACTTTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028927
TKTL2 MISSION shRNA Bacterial Glycerol Stock
transketolase-like 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028927.3-216s21c1
Sequence:CCGGTCCATACCATGAGGTACAAACCTCGAGGTTTGTACCTCATGGTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028927.3-644s21c1
Sequence:CCGGGAGCACTGTACAGCCGTTTATCTCGAGATAAACGGCTGTACAGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028927.3-1196s21c1
Sequence:CCGGGCCACACGAGGACGAACTATTCTCGAGAATAGTTCGTCCTCGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028927.3-1029s21c1
Sequence:CCGGACGGCTTGGCTCTGGCTAAATCTCGAGATTTAGCCAGAGCCAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028927.3-1685s21c1
Sequence:CCGGCTGGATGCTGTCACCATTATCCTCGAGGATAATGGTGACAGCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028927.1-1485s1c1
Sequence:CCGGGCAGTTATTTATACAGCTGAACTCGAGTTCAGCTGTATAAATAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028927
TKTL2 MISSION shRNA shRNA Plasmid DNA
transketolase-like 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028927.3-216s21c1
Sequence:CCGGTCCATACCATGAGGTACAAACCTCGAGGTTTGTACCTCATGGTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028927.3-644s21c1
Sequence:CCGGGAGCACTGTACAGCCGTTTATCTCGAGATAAACGGCTGTACAGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028927.3-1196s21c1
Sequence:CCGGGCCACACGAGGACGAACTATTCTCGAGAATAGTTCGTCCTCGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028927.3-1029s21c1
Sequence:CCGGACGGCTTGGCTCTGGCTAAATCTCGAGATTTAGCCAGAGCCAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028927.3-1685s21c1
Sequence:CCGGCTGGATGCTGTCACCATTATCCTCGAGGATAATGGTGACAGCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028927.1-1485s1c1
Sequence:CCGGGCAGTTATTTATACAGCTGAACTCGAGTTCAGCTGTATAAATAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028927
TKTL2 MISSION shRNA Lentiviral Transduction Particles
transketolase-like 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028927.3-216s21c1
Sequence:CCGGTCCATACCATGAGGTACAAACCTCGAGGTTTGTACCTCATGGTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028927.3-644s21c1
Sequence:CCGGGAGCACTGTACAGCCGTTTATCTCGAGATAAACGGCTGTACAGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028927.3-1196s21c1
Sequence:CCGGGCCACACGAGGACGAACTATTCTCGAGAATAGTTCGTCCTCGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028927.3-1029s21c1
Sequence:CCGGACGGCTTGGCTCTGGCTAAATCTCGAGATTTAGCCAGAGCCAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028927.3-1685s21c1
Sequence:CCGGCTGGATGCTGTCACCATTATCCTCGAGGATAATGGTGACAGCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028927.1-1485s1c1
Sequence:CCGGGCAGTTATTTATACAGCTGAACTCGAGTTCAGCTGTATAAATAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks