EMAIL THIS PAGE TO A FRIEND

TLCD1

TLC domain containing 1

UniProtKB ID: Q96CP7
Gene ID:
Mouse(68385) TLC domain containing 1
Rat(287472) TLC domain containing 1
Zebrafish(450051) TLC domain containing 1
chicken(417575) TLC domain containing 1
dog(480628) TLC domain containing 1
domestic cat(101085082) TLC domain containing 1
cow(100125601) TLC domain containing 1
sheep(101120761) TLC domain containing 1
naked mole-rat(101715640) TLC domain containing 1
domestic guinea pig(100725839) TLC domain containing 1
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138463 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138463 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138463 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026708 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026708 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026708 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138463 Rosetta Predictions human pricing
NM_001013858 Rosetta Predictions rat pricing
NM_026708 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101236 predicted 609
2 SASI_Hs01_00101237 predicted 251
3 SASI_Hs01_00101238 predicted 436
4 SASI_Hs02_00363643 predicted 316
5 SASI_Hs01_00101239 predicted 622
6 SASI_Hs01_00101240 predicted 477
7 SASI_Hs01_00101241 predicted 719
8 SASI_Hs01_00101242 predicted 332
9 SASI_Hs01_00101243 predicted 305
10 SASI_Hs01_00101244 predicted 610
11 SASI_Hs01_00101235 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013858 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093649 predicted 746
2 SASI_Rn01_00093650 predicted 338
3 SASI_Rn01_00093651 predicted 595
4 SASI_Rn01_00093652 predicted 351
5 SASI_Rn01_00093653 predicted 693
6 SASI_Rn01_00093654 predicted 623
7 SASI_Rn01_00093655 predicted 846
8 SASI_Rn01_00093656 predicted 608
9 SASI_Rn01_00093657 predicted 349
10 SASI_Rn02_00201125 predicted 397
11 SASI_Rn01_00093658 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026708 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075091 predicted 665
2 SASI_Mm01_00075092 predicted 586
3 SASI_Mm01_00075093 predicted 874
4 SASI_Mm01_00075094 predicted 508
5 SASI_Mm01_00075095 predicted 318
6 SASI_Mm01_00075096 predicted 845
7 SASI_Mm01_00075097 predicted 816
8 SASI_Mm02_00330743 predicted 533
9 SASI_Mm01_00075098 predicted 618
10 SASI_Mm01_00075099 predicted 889
11 SASI_Mm01_00075100 predicted 417
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138463
TLCD1 MISSION shRNA Bacterial Glycerol Stock
TLC domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138463.2-319s1c1
Sequence:CCGGCCTGACATGTTAGTGGAGATTCTCGAGAATCTCCACTAACATGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138463.2-825s1c1
Sequence:CCGGGCAACACAAAGACAAGTTCTTCTCGAGAAGAACTTGTCTTTGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138463.2-624s1c1
Sequence:CCGGCAAGTATGTGAACCTGGTCATCTCGAGATGACCAGGTTCACATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138463.2-526s1c1
Sequence:CCGGGTCTTAACACTACTGGTGGAACTCGAGTTCCACCAGTAGTGTTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138463.3-454s21c1
Sequence:CCGGATACCTTGTCCATCACGTCATCTCGAGATGACGTGATGGACAAGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138463
TLCD1 MISSION shRNA shRNA Plasmid DNA
TLC domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138463.2-319s1c1
Sequence:CCGGCCTGACATGTTAGTGGAGATTCTCGAGAATCTCCACTAACATGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138463.2-825s1c1
Sequence:CCGGGCAACACAAAGACAAGTTCTTCTCGAGAAGAACTTGTCTTTGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138463.2-624s1c1
Sequence:CCGGCAAGTATGTGAACCTGGTCATCTCGAGATGACCAGGTTCACATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138463.2-526s1c1
Sequence:CCGGGTCTTAACACTACTGGTGGAACTCGAGTTCCACCAGTAGTGTTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138463.3-454s21c1
Sequence:CCGGATACCTTGTCCATCACGTCATCTCGAGATGACGTGATGGACAAGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138463
TLCD1 MISSION shRNA Lentiviral Transduction Particles
TLC domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138463.2-319s1c1
Sequence:CCGGCCTGACATGTTAGTGGAGATTCTCGAGAATCTCCACTAACATGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138463.2-825s1c1
Sequence:CCGGGCAACACAAAGACAAGTTCTTCTCGAGAAGAACTTGTCTTTGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138463.2-624s1c1
Sequence:CCGGCAAGTATGTGAACCTGGTCATCTCGAGATGACCAGGTTCACATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138463.2-526s1c1
Sequence:CCGGGTCTTAACACTACTGGTGGAACTCGAGTTCCACCAGTAGTGTTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138463.3-454s21c1
Sequence:CCGGATACCTTGTCCATCACGTCATCTCGAGATGACGTGATGGACAAGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026708
VALIDATED
TLCD1 MISSION shRNA Bacterial Glycerol Stock
TLC domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026708.1-308s1c1
Sequence:CCGGGAAATGCTGGTGGAGATTGAACTCGAGTTCAATCTCCACCAGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026708.1-425s1c1
Sequence:CCGGGCTTCTTGGGAATACCTTGTTCTCGAGAACAAGGTATTCCCAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026708.1-537s1c1
Sequence:CCGGGCAACATCTTCCTCACCTTAACTCGAGTTAAGGTGAGGAAGATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026708.1-538s21c1
Sequence:CCGGCAACATCTTCCTCACCTTAAGCTCGAGCTTAAGGTGAGGAAGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026708.1-335s21c1
Sequence:CCGGTGGTCAGCTTCTGGCTATTTGCTCGAGCAAATAGCCAGAAGCTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216318    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026708.1-883s1c1
Sequence:CCGGGCCAATTGCTCTGTAACATAACTCGAGTTATGTTACAGAGCAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026708.1-598s21c1
Sequence:CCGGCTACAAGGTCAACAAGTATATCTCGAGATATACTTGTTGACCTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026708.1-1040s21c1
Sequence:CCGGACCGGTTGGGCATGGCTAAATCTCGAGATTTAGCCATGCCCAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026708
VALIDATED
TLCD1 MISSION shRNA shRNA Plasmid DNA
TLC domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026708.1-308s1c1
Sequence:CCGGGAAATGCTGGTGGAGATTGAACTCGAGTTCAATCTCCACCAGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026708.1-425s1c1
Sequence:CCGGGCTTCTTGGGAATACCTTGTTCTCGAGAACAAGGTATTCCCAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026708.1-537s1c1
Sequence:CCGGGCAACATCTTCCTCACCTTAACTCGAGTTAAGGTGAGGAAGATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026708.1-538s21c1
Sequence:CCGGCAACATCTTCCTCACCTTAAGCTCGAGCTTAAGGTGAGGAAGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026708.1-335s21c1
Sequence:CCGGTGGTCAGCTTCTGGCTATTTGCTCGAGCAAATAGCCAGAAGCTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216318    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026708.1-883s1c1
Sequence:CCGGGCCAATTGCTCTGTAACATAACTCGAGTTATGTTACAGAGCAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026708.1-598s21c1
Sequence:CCGGCTACAAGGTCAACAAGTATATCTCGAGATATACTTGTTGACCTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026708.1-1040s21c1
Sequence:CCGGACCGGTTGGGCATGGCTAAATCTCGAGATTTAGCCATGCCCAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026708
VALIDATED
TLCD1 MISSION shRNA Lentiviral Transduction Particles
TLC domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026708.1-308s1c1
Sequence:CCGGGAAATGCTGGTGGAGATTGAACTCGAGTTCAATCTCCACCAGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026708.1-425s1c1
Sequence:CCGGGCTTCTTGGGAATACCTTGTTCTCGAGAACAAGGTATTCCCAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026708.1-537s1c1
Sequence:CCGGGCAACATCTTCCTCACCTTAACTCGAGTTAAGGTGAGGAAGATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026708.1-538s21c1
Sequence:CCGGCAACATCTTCCTCACCTTAAGCTCGAGCTTAAGGTGAGGAAGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026708.1-335s21c1
Sequence:CCGGTGGTCAGCTTCTGGCTATTTGCTCGAGCAAATAGCCAGAAGCTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216318    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026708.1-883s1c1
Sequence:CCGGGCCAATTGCTCTGTAACATAACTCGAGTTATGTTACAGAGCAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026708.1-598s21c1
Sequence:CCGGCTACAAGGTCAACAAGTATATCTCGAGATATACTTGTTGACCTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026708.1-1040s21c1
Sequence:CCGGACCGGTTGGGCATGGCTAAATCTCGAGATTTAGCCATGCCCAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks