EMAIL THIS PAGE TO A FRIEND

TLCD2

TLC domain containing 2

UniProtKB ID: A6NGC4
Gene ID:
Mouse(380712) TLC domain containing 2
Rat(497955) TLC domain containing 2
domestic guinea pig(100736116) TLC domain containing 2
naked mole-rat(101726448) TLC domain containing 2
cow(506954) TLC domain containing 2
sheep(101116742) TLC domain containing 2
Zebrafish(559420) TLC domain containing 2
chicken(427825) TLC domain containing 2
domestic cat(101084836) TLC domain containing 2
dog(611258) TLC domain containing 2
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027249 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027249 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027249 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001126126 Rosetta Predictions human pricing
XM_001717022 Rosetta Predictions human pricing
XM_001718130 Rosetta Predictions human pricing
XM_001080690 Rosetta Predictions rat pricing
XM_573142 Rosetta Predictions rat pricing
NM_027249 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001126126 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00382429 predicted 810
2 SASI_Hs02_00382430 predicted 1163
3 SASI_Hs02_00382431 predicted 1157
4 SASI_Hs02_00382432 predicted 1258
5 SASI_Hs02_00382433 predicted 841
6 SASI_Hs02_00382434 predicted 108
7 SASI_Hs02_00382435 predicted 1262
8 SASI_Hs02_00382436 predicted 1181
9 SASI_Hs02_00382437 predicted 837
10 SASI_Hs02_00382438 predicted 1153
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717022 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00414533 predicted 808
2 SASI_Hs02_00414534 predicted 840
3 SASI_Hs02_00414535 predicted 901
4 SASI_Hs02_00414536 predicted 833
5 SASI_Hs02_00414537 predicted 856
6 SASI_Hs02_00414538 predicted 955
7 SASI_Hs02_00414539 predicted 838
8 SASI_Hs02_00414540 predicted 875
9 SASI_Hs02_00414541 predicted 1084
10 SASI_Hs02_00414542 predicted 909
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718130 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00421807 predicted 812
2 SASI_Hs02_00421808 predicted 840
3 SASI_Hs02_00421809 predicted 905
4 SASI_Hs02_00421810 predicted 838
5 SASI_Hs02_00421811 predicted 859
6 SASI_Hs02_00421812 predicted 960
7 SASI_Hs02_00421813 predicted 837
8 SASI_Hs02_00421814 predicted 868
9 SASI_Hs02_00421815 predicted 1087
10 SASI_Hs02_00421816 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080690 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368960 predicted 448
2 SASI_Rn02_00368961 predicted 581
3 SASI_Rn02_00368962 predicted 664
4 SASI_Rn02_00368963 predicted 698
5 SASI_Rn02_00368964 predicted 501
6 SASI_Rn02_00368965 predicted 317
7 SASI_Rn02_00368966 predicted 536
8 SASI_Rn02_00368967 predicted 302
9 SASI_Rn02_00368968 predicted 656
10 SASI_Rn02_00368969 predicted 218
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573142 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399884 predicted 455
2 SASI_Rn02_00399885 predicted 585
3 SASI_Rn02_00399886 predicted 668
4 SASI_Rn02_00399887 predicted 699
5 SASI_Rn02_00399888 predicted 499
6 SASI_Rn02_00399889 predicted 317
7 SASI_Rn02_00399890 predicted 535
8 SASI_Rn02_00399891 predicted 307
9 SASI_Rn02_00399892 predicted 656
10 SASI_Rn02_00399893 predicted 218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027249 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131859 predicted 803
2 SASI_Mm01_00131860 predicted 359
3 SASI_Mm01_00131861 predicted 777
4 SASI_Mm01_00131862 predicted 315
5 SASI_Mm02_00331821 predicted 529
6 SASI_Mm01_00131863 predicted 771
7 SASI_Mm01_00131864 predicted 396
8 SASI_Mm01_00131865 predicted 448
9 SASI_Mm01_00131866 predicted 251
10 SASI_Mm01_00131867 predicted 496
11 SASI_Mm01_00131868 predicted 571
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027249
VALIDATED
TLCD2 MISSION shRNA Bacterial Glycerol Stock
TLC domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027249.2-488s21c1
Sequence:CCGGCTGTTGTGTCTGGCCACTATGCTCGAGCATAGTGGCCAGACACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027249.2-369s21c1
Sequence:CCGGAGCAGTGTCAGTGGGTTATTTCTCGAGAAATAACCCACTGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027249.2-807s21c1
Sequence:CCGGGTCTCAGCCCTACCCGTTTATCTCGAGATAAACGGGTAGGGCTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027249.2-319s21c1
Sequence:CCGGATGGTCACCGACCCAATTAATCTCGAGATTAATTGGGTCGGTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027249.2-549s1c1
Sequence:CCGGCATCTGTTTGCATCTACGGAACTCGAGTTCCGTAGATGCAAACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027249
VALIDATED
TLCD2 MISSION shRNA shRNA Plasmid DNA
TLC domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027249.2-488s21c1
Sequence:CCGGCTGTTGTGTCTGGCCACTATGCTCGAGCATAGTGGCCAGACACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027249.2-369s21c1
Sequence:CCGGAGCAGTGTCAGTGGGTTATTTCTCGAGAAATAACCCACTGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027249.2-807s21c1
Sequence:CCGGGTCTCAGCCCTACCCGTTTATCTCGAGATAAACGGGTAGGGCTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027249.2-319s21c1
Sequence:CCGGATGGTCACCGACCCAATTAATCTCGAGATTAATTGGGTCGGTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027249.2-549s1c1
Sequence:CCGGCATCTGTTTGCATCTACGGAACTCGAGTTCCGTAGATGCAAACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027249
VALIDATED
TLCD2 MISSION shRNA Lentiviral Transduction Particles
TLC domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027249.2-488s21c1
Sequence:CCGGCTGTTGTGTCTGGCCACTATGCTCGAGCATAGTGGCCAGACACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027249.2-369s21c1
Sequence:CCGGAGCAGTGTCAGTGGGTTATTTCTCGAGAAATAACCCACTGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027249.2-807s21c1
Sequence:CCGGGTCTCAGCCCTACCCGTTTATCTCGAGATAAACGGGTAGGGCTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027249.2-319s21c1
Sequence:CCGGATGGTCACCGACCCAATTAATCTCGAGATTAATTGGGTCGGTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027249.2-549s1c1
Sequence:CCGGCATCTGTTTGCATCTACGGAACTCGAGTTCCGTAGATGCAAACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks