EMAIL THIS PAGE TO A FRIEND

TLDC1

TBC/LysM-associated domain containing 1

Synonyms: KIAA1609
UniProtKB ID: Q6P9B6, Q8IZ64, Q9HCG3, Q9NTE8
Gene ID:
Mouse(74347) TBC/LysM associated domain containing 1
Rat(307901) TBC/LysM-associated domain containing 1
Zebrafish(561678) TBC/LysM-associated domain containing 1
dog(489681) TBC/LysM-associated domain containing 1
cow(531539) TBC/LysM-associated domain containing 1
naked mole-rat(101723427) TBC/LysM-associated domain containing 1
domestic guinea pig(100730670) TBC/LysM-associated domain containing 1
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028883 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028883 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028883 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020947 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020947 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020947 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020947 Rosetta Predictions human pricing
XM_226525 Rosetta Predictions rat pricing
XR_009252 Rosetta Predictions rat pricing
NM_028883 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247281 predicted 740
2 SASI_Hs01_00247282 predicted 1457
3 SASI_Hs01_00247283 predicted 424
4 SASI_Hs01_00247284 predicted 1429
5 SASI_Hs01_00247285 predicted 1010
6 SASI_Hs01_00247287 predicted 1445
7 SASI_Hs01_00247288 predicted 216
8 SASI_Hs01_00247289 predicted 515
9 SASI_Hs02_00354356 predicted 1158
10 SASI_Hs01_00247290 predicted 669
11 SASI_Hs01_00247286 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226525 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383645 predicted 997
2 SASI_Rn02_00383646 predicted 304
3 SASI_Rn02_00383647 predicted 252
4 SASI_Rn02_00383648 predicted 608
5 SASI_Rn02_00383649 predicted 892
6 SASI_Rn02_00383650 predicted 859
7 SASI_Rn02_00383651 predicted 1012
8 SASI_Rn02_00383652 predicted 268
9 SASI_Rn02_00383653 predicted 1015
10 SASI_Rn02_00383654 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009252 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00161902 predicted 345
2 SASI_Rn01_00161904 predicted 193
3 SASI_Rn02_00419222 predicted 957
4 SASI_Rn02_00419223 predicted 746
5 SASI_Rn02_00419224 predicted 951
6 SASI_Rn01_00161906 predicted 249
7 SASI_Rn02_00419225 predicted 755
8 SASI_Rn01_00161907 predicted 604
9 SASI_Rn02_00419226 predicted 249
10 SASI_Rn02_00419227 predicted 917
11 SASI_Rn01_00161903 predicted 199
12 SASI_Rn01_00161905 predicted 606
13 SASI_Rn01_00161908 predicted 467
14 SASI_Rn01_00161909 predicted 629
15 SASI_Rn01_00161910 predicted 469
16 SASI_Rn01_00161911 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028883 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177925 predicted 1086
2 SASI_Mm01_00177926 predicted 1445
3 SASI_Mm02_00334567 predicted 1733
4 SASI_Mm01_00177927 predicted 1727
5 SASI_Mm01_00177929 predicted 199
6 SASI_Mm01_00177930 predicted 388
7 SASI_Mm01_00177931 predicted 1678
8 SASI_Mm01_00177932 predicted 218
9 SASI_Mm02_00334568 predicted 340
10 SASI_Mm01_00177934 predicted 1318
11 SASI_Mm01_00177928 predicted 1458
12 SASI_Mm01_00177933 predicted 1733
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028883
VALIDATED
TLDC1 MISSION shRNA Bacterial Glycerol Stock
TBC/LysM-associated domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028883.1-394s1c1
Sequence:CCGGCCTAATGGTTATGAACATGATCTCGAGATCATGTTCATAACCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028883.1-1102s1c1
Sequence:CCGGCCACTTCATGTACTTGAATTACTCGAGTAATTCAAGTACATGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028883.2-966s21c1
Sequence:CCGGACAGGGATGGCTACGTCTTTGCTCGAGCAAAGACGTAGCCATCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028883.2-1081s21c1
Sequence:CCGGCCTGCACACGGGCTACAATAACTCGAGTTATTGTAGCCCGTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028883.2-1268s21c1
Sequence:CCGGGAGGACTTCCTGTTCGATAAGCTCGAGCTTATCGAACAGGAAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028883.2-419s21c1
Sequence:CCGGGATGCAGAGGGTCCTACAAAGCTCGAGCTTTGTAGGACCCTCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028883.2-1522s21c1
Sequence:CCGGGAGCAGAGAGCGTCTAGATTCCTCGAGGAATCTAGACGCTCTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028883.2-256s1c1
Sequence:CCGGGATGGTCACCAGACTGTATAACTCGAGTTATACAGTCTGGTGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028883
VALIDATED
TLDC1 MISSION shRNA shRNA Plasmid DNA
TBC/LysM-associated domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028883.1-394s1c1
Sequence:CCGGCCTAATGGTTATGAACATGATCTCGAGATCATGTTCATAACCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028883.1-1102s1c1
Sequence:CCGGCCACTTCATGTACTTGAATTACTCGAGTAATTCAAGTACATGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028883.2-966s21c1
Sequence:CCGGACAGGGATGGCTACGTCTTTGCTCGAGCAAAGACGTAGCCATCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028883.2-1081s21c1
Sequence:CCGGCCTGCACACGGGCTACAATAACTCGAGTTATTGTAGCCCGTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028883.2-1268s21c1
Sequence:CCGGGAGGACTTCCTGTTCGATAAGCTCGAGCTTATCGAACAGGAAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028883.2-419s21c1
Sequence:CCGGGATGCAGAGGGTCCTACAAAGCTCGAGCTTTGTAGGACCCTCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028883.2-1522s21c1
Sequence:CCGGGAGCAGAGAGCGTCTAGATTCCTCGAGGAATCTAGACGCTCTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028883.2-256s1c1
Sequence:CCGGGATGGTCACCAGACTGTATAACTCGAGTTATACAGTCTGGTGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028883
VALIDATED
TLDC1 MISSION shRNA Lentiviral Transduction Particles
TBC/LysM-associated domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028883.1-394s1c1
Sequence:CCGGCCTAATGGTTATGAACATGATCTCGAGATCATGTTCATAACCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028883.1-1102s1c1
Sequence:CCGGCCACTTCATGTACTTGAATTACTCGAGTAATTCAAGTACATGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028883.2-966s21c1
Sequence:CCGGACAGGGATGGCTACGTCTTTGCTCGAGCAAAGACGTAGCCATCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028883.2-1081s21c1
Sequence:CCGGCCTGCACACGGGCTACAATAACTCGAGTTATTGTAGCCCGTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028883.2-1268s21c1
Sequence:CCGGGAGGACTTCCTGTTCGATAAGCTCGAGCTTATCGAACAGGAAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028883.2-419s21c1
Sequence:CCGGGATGCAGAGGGTCCTACAAAGCTCGAGCTTTGTAGGACCCTCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028883.2-1522s21c1
Sequence:CCGGGAGCAGAGAGCGTCTAGATTCCTCGAGGAATCTAGACGCTCTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028883.2-256s1c1
Sequence:CCGGGATGGTCACCAGACTGTATAACTCGAGTTATACAGTCTGGTGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020947
VALIDATED
TLDC1 MISSION shRNA Bacterial Glycerol Stock
TBC/LysM-associated domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020947.2-777s1c1
Sequence:CCGGGCTCGTCTCTTGATCTGACTACTCGAGTAGTCAGATCAAGAGACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_020947.2-176s1c1
Sequence:CCGGGCAGAGATTGATCAATTGTTTCTCGAGAAACAATTGATCAATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121910    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020947.2-1731s1c1
Sequence:CCGGCCAAGAAATCTTGTGTCAAATCTCGAGATTTGACACAAGATTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143721    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020947.2-2936s1c1
Sequence:CCGGGCCATAGTAAATCGAGCTGTTCTCGAGAACAGCTCGATTTACTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020947.2-1718s1c1
Sequence:CCGGCCTCAGGATCTCTCCAAGAAACTCGAGTTTCTTGGAGAGATCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020947.2-1201s1c1
Sequence:CCGGGCAGCACAATTACTTTGGGCTCTCGAGAGCCCAAAGTAATTGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_020947.2-1301s1c1
Sequence:CCGGGCTCAGGAGAACTTCCAGTTTCTCGAGAAACTGGAAGTTCTCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020947.2-2430s1c1
Sequence:CCGGGCACCCTAAGTTTGGGAACTTCTCGAGAAGTTCCCAAACTTAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020947.2-1315s1c1
Sequence:CCGGCCAGTTTGATAAGATGGAGGTCTCGAGACCTCCATCTTATCAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020947.2-197s1c1
Sequence:CCGGGATGCTCTGTCATCAGATAAACTCGAGTTTATCTGATGACAGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020947
VALIDATED
TLDC1 MISSION shRNA shRNA Plasmid DNA
TBC/LysM-associated domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020947.2-777s1c1
Sequence:CCGGGCTCGTCTCTTGATCTGACTACTCGAGTAGTCAGATCAAGAGACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_020947.2-176s1c1
Sequence:CCGGGCAGAGATTGATCAATTGTTTCTCGAGAAACAATTGATCAATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121910    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020947.2-1731s1c1
Sequence:CCGGCCAAGAAATCTTGTGTCAAATCTCGAGATTTGACACAAGATTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143721    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020947.2-2936s1c1
Sequence:CCGGGCCATAGTAAATCGAGCTGTTCTCGAGAACAGCTCGATTTACTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020947.2-1718s1c1
Sequence:CCGGCCTCAGGATCTCTCCAAGAAACTCGAGTTTCTTGGAGAGATCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020947.2-1201s1c1
Sequence:CCGGGCAGCACAATTACTTTGGGCTCTCGAGAGCCCAAAGTAATTGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_020947.2-1301s1c1
Sequence:CCGGGCTCAGGAGAACTTCCAGTTTCTCGAGAAACTGGAAGTTCTCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020947.2-2430s1c1
Sequence:CCGGGCACCCTAAGTTTGGGAACTTCTCGAGAAGTTCCCAAACTTAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020947.2-1315s1c1
Sequence:CCGGCCAGTTTGATAAGATGGAGGTCTCGAGACCTCCATCTTATCAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020947.2-197s1c1
Sequence:CCGGGATGCTCTGTCATCAGATAAACTCGAGTTTATCTGATGACAGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020947
VALIDATED
TLDC1 MISSION shRNA Lentiviral Transduction Particles
TBC/LysM-associated domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020947.2-777s1c1
Sequence:CCGGGCTCGTCTCTTGATCTGACTACTCGAGTAGTCAGATCAAGAGACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_020947.2-176s1c1
Sequence:CCGGGCAGAGATTGATCAATTGTTTCTCGAGAAACAATTGATCAATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121910    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020947.2-1731s1c1
Sequence:CCGGCCAAGAAATCTTGTGTCAAATCTCGAGATTTGACACAAGATTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143721    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020947.2-2936s1c1
Sequence:CCGGGCCATAGTAAATCGAGCTGTTCTCGAGAACAGCTCGATTTACTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020947.2-1718s1c1
Sequence:CCGGCCTCAGGATCTCTCCAAGAAACTCGAGTTTCTTGGAGAGATCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020947.2-1201s1c1
Sequence:CCGGGCAGCACAATTACTTTGGGCTCTCGAGAGCCCAAAGTAATTGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_020947.2-1301s1c1
Sequence:CCGGGCTCAGGAGAACTTCCAGTTTCTCGAGAAACTGGAAGTTCTCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020947.2-2430s1c1
Sequence:CCGGGCACCCTAAGTTTGGGAACTTCTCGAGAAGTTCCCAAACTTAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020947.2-1315s1c1
Sequence:CCGGCCAGTTTGATAAGATGGAGGTCTCGAGACCTCCATCTTATCAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020947.2-197s1c1
Sequence:CCGGGATGCTCTGTCATCAGATAAACTCGAGTTTATCTGATGACAGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks