EMAIL THIS PAGE TO A FRIEND

TLDC2

TBC/LysM-associated domain containing 2

Synonyms: C20orf118 dJ132F21.2
UniProtKB ID: A0PJX2, B3KVU8
Gene ID:
Mouse(383766) TBC/LysM associated domain containing 2
Rat(502689) TBC/LysM-associated domain containing 2
domestic guinea pig(100727103) TBC/LysM-associated domain containing 2
naked mole-rat(101708069) TBC/LysM-associated domain containing 2
cow(512927) TBC/LysM-associated domain containing 2
chicken(101665603) TBC/LysM-associated domain containing 2
dog(485861) TBC/LysM-associated domain containing 2
chicken(101747236) TBC/LysM-associated domain containing 2
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080628 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080628 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080628 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021631 MISSION® esiRNA esiRNA human C20orf118 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080628 Rosetta Predictions human pricing
XM_578186 Rosetta Predictions rat pricing
XM_357232 Rosetta Predictions mouse pricing
XR_005106 Rosetta Predictions mouse pricing
XR_035603 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080628 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224223 predicted 963
2 SASI_Hs01_00224224 predicted 338
3 SASI_Hs01_00224225 predicted 499
4 SASI_Hs01_00224227 predicted 977
5 SASI_Hs01_00224231 predicted 1002
6 SASI_Hs01_00224232 predicted 914
7 SASI_Hs02_00362372 predicted 470
8 SASI_Hs02_00362373 predicted 1119
9 SASI_Hs01_00224226 predicted 394
10 SASI_Hs01_00224228 predicted 870
11 SASI_Hs01_00224229 predicted 884
12 SASI_Hs01_00224230 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578186 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00407650 predicted 200
2 SASI_Rn02_00407651 predicted 203
3 SASI_Rn02_00407652 predicted 201
4 SASI_Rn02_00407653 predicted 193
5 SASI_Rn02_00407654 predicted 1129
6 SASI_Rn02_00407655 predicted 513
7 SASI_Rn02_00407656 predicted 131
8 SASI_Rn02_00407657 predicted 271
9 SASI_Rn02_00407658 predicted 946
10 SASI_Rn02_00407659 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_357232 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221390 predicted 377
2 SASI_Mm01_00221391 predicted 368
3 SASI_Mm01_00221392 predicted 375
4 SASI_Mm02_00426038 predicted 323
5 SASI_Mm01_00221393 predicted 345
6 SASI_Mm01_00221394 predicted 339
7 SASI_Mm01_00221395 predicted 382
8 SASI_Mm01_00221396 predicted 387
9 SASI_Mm01_00221397 predicted 390
10 SASI_Mm01_00221398 predicted 420
11 SASI_Mm01_00221399 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005106 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00249557 predicted 406
2 SASI_Mm01_00249558 predicted 400
3 SASI_Mm01_00249559 predicted 407
4 SASI_Mm01_00249560 predicted 380
5 SASI_Mm01_00249561 predicted 370
6 SASI_Mm01_00249562 predicted 424
7 SASI_Mm01_00249563 predicted 421
8 SASI_Mm01_00249564 predicted 417
9 SASI_Mm01_00249565 predicted 446
10 SASI_Mm01_00249566 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_035603 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00483478 predicted 375
2 SASI_Mm02_00483479 predicted 365
3 SASI_Mm02_00483480 predicted 369
4 SASI_Mm02_00483481 predicted 330
5 SASI_Mm02_00483482 predicted 343
6 SASI_Mm02_00483483 predicted 342
7 SASI_Mm02_00483484 predicted 387
8 SASI_Mm02_00483485 predicted 395
9 SASI_Mm02_00483486 predicted 388
10 SASI_Mm02_00483487 predicted 416
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080628
TLDC2 MISSION shRNA Bacterial Glycerol Stock
TBC/LysM-associated domain containing 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080628.1-865s21c1
Sequence:CCGGATAACATCGCCATCCTATTAACTCGAGTTAATAGGATGGCGATGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080628.1-456s21c1
Sequence:CCGGTGGACTGGAAGCAACTCTTTCCTCGAGGAAAGAGTTGCTTCCAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080628.1-399s21c1
Sequence:CCGGTATGGTACTGGCGAGACATTCCTCGAGGAATGTCTCGCCAGTACCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080628.1-434s21c1
Sequence:CCGGCCCACAGCTGAAGGTCTTTAACTCGAGTTAAAGACCTTCAGCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080628.1-336s21c1
Sequence:CCGGGACCAGGACGGGCAGATATTTCTCGAGAAATATCTGCCCGTCCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080628.1-482s1c1
Sequence:CCGGGAAGGGAGACTTGGATTCACTCTCGAGAGTGAATCCAAGTCTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080628.1-449s1c1
Sequence:CCGGCTTTAAGTGGACTGGAAGCAACTCGAGTTGCTTCCAGTCCACTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080628.1-381s1c1
Sequence:CCGGCGACTCAGCAAAGGCTTCTATCTCGAGATAGAAGCCTTTGCTGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080628
TLDC2 MISSION shRNA shRNA Plasmid DNA
TBC/LysM-associated domain containing 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080628.1-865s21c1
Sequence:CCGGATAACATCGCCATCCTATTAACTCGAGTTAATAGGATGGCGATGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080628.1-456s21c1
Sequence:CCGGTGGACTGGAAGCAACTCTTTCCTCGAGGAAAGAGTTGCTTCCAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080628.1-399s21c1
Sequence:CCGGTATGGTACTGGCGAGACATTCCTCGAGGAATGTCTCGCCAGTACCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080628.1-434s21c1
Sequence:CCGGCCCACAGCTGAAGGTCTTTAACTCGAGTTAAAGACCTTCAGCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080628.1-336s21c1
Sequence:CCGGGACCAGGACGGGCAGATATTTCTCGAGAAATATCTGCCCGTCCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080628.1-482s1c1
Sequence:CCGGGAAGGGAGACTTGGATTCACTCTCGAGAGTGAATCCAAGTCTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080628.1-449s1c1
Sequence:CCGGCTTTAAGTGGACTGGAAGCAACTCGAGTTGCTTCCAGTCCACTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080628.1-381s1c1
Sequence:CCGGCGACTCAGCAAAGGCTTCTATCTCGAGATAGAAGCCTTTGCTGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080628
TLDC2 MISSION shRNA Lentiviral Transduction Particles
TBC/LysM-associated domain containing 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080628.1-865s21c1
Sequence:CCGGATAACATCGCCATCCTATTAACTCGAGTTAATAGGATGGCGATGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080628.1-456s21c1
Sequence:CCGGTGGACTGGAAGCAACTCTTTCCTCGAGGAAAGAGTTGCTTCCAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080628.1-399s21c1
Sequence:CCGGTATGGTACTGGCGAGACATTCCTCGAGGAATGTCTCGCCAGTACCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080628.1-434s21c1
Sequence:CCGGCCCACAGCTGAAGGTCTTTAACTCGAGTTAAAGACCTTCAGCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080628.1-336s21c1
Sequence:CCGGGACCAGGACGGGCAGATATTTCTCGAGAAATATCTGCCCGTCCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080628.1-482s1c1
Sequence:CCGGGAAGGGAGACTTGGATTCACTCTCGAGAGTGAATCCAAGTCTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080628.1-449s1c1
Sequence:CCGGCTTTAAGTGGACTGGAAGCAACTCGAGTTGCTTCCAGTCCACTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080628.1-381s1c1
Sequence:CCGGCGACTCAGCAAAGGCTTCTATCTCGAGATAGAAGCCTTTGCTGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks