EMAIL THIS PAGE TO A FRIEND

TLE1

transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)

Synonyms: ESG ESG1 GRG1
UniProtKB ID: Q04724, A8K495, Q5T3G4, Q969V9
Gene ID:
Mouse(21885) transducin-like enhancer of split 1, homolog of Drosophila E(spl)
Rat(362533) transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)
Zebrafish(564019) transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)
domestic cat(101098410) transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)
Horse(100061341) transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)
dog(476314) transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)
chicken(427450) transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)
cow(512888) transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)
naked mole-rat(101720622) transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)
Domestic Rabbit(100354911) transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)
domestic guinea pig(100732024) transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)
189 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011599 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011599 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011599 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005077 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005077 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005077 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083211 MISSION® esiRNA esiRNA human TLE1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005077 Rosetta Predictions human pricing
XM_001066887 Rosetta Predictions rat pricing
XM_342851 Rosetta Predictions rat pricing
NM_011599 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005077 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196921 predicted 1316
2 SASI_Hs01_00196922 predicted 2560
3 SASI_Hs01_00196923 predicted 564
4 SASI_Hs02_00338915 predicted 640
5 SASI_Hs01_00196925 predicted 1049
6 SASI_Hs01_00196926 predicted 816
7 SASI_Hs01_00196927 predicted 1173
8 SASI_Hs01_00196928 predicted 2547
9 SASI_Hs01_00196929 predicted 709
10 SASI_Hs01_00196930 predicted 2040
11 SASI_Hs01_00196924 predicted 1079
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066887 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00319069 predicted 2517
2 SASI_Rn02_00319070 predicted 1548
3 SASI_Rn02_00319071 predicted 2871
4 SASI_Rn02_00319072 predicted 2503
5 SASI_Rn02_00319073 predicted 1639
6 SASI_Rn02_00319074 predicted 1033
7 SASI_Rn02_00319075 predicted 1739
8 SASI_Rn02_00319076 predicted 1148
9 SASI_Rn02_00319077 predicted 1181
10 SASI_Rn02_00319078 predicted 1537
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342851 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394881 predicted 2514
2 SASI_Rn02_00394882 predicted 1548
3 SASI_Rn02_00394883 predicted 2874
4 SASI_Rn02_00394884 predicted 2502
5 SASI_Rn02_00394885 predicted 1643
6 SASI_Rn02_00394886 predicted 1038
7 SASI_Rn02_00394887 predicted 1734
8 SASI_Rn02_00394888 predicted 1149
9 SASI_Rn02_00394889 predicted 1183
10 SASI_Rn02_00394890 predicted 1534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011599 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069933 predicted 2517
2 SASI_Mm01_00069934 predicted 2502
3 SASI_Mm02_00321014 predicted 1545
4 SASI_Mm02_00321015 predicted 1536
5 SASI_Mm01_00069935 predicted 2564
6 SASI_Mm01_00069936 predicted 1171
7 SASI_Mm01_00069937 predicted 1644
8 SASI_Mm01_00069938 predicted 3020
9 SASI_Mm01_00069939 predicted 2893
10 SASI_Mm01_00069940 predicted 1034
11 SASI_Mm01_00069932 predicted 2829
12 SASI_Mm01_00069941 predicted 2966
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011599
VALIDATED
TLE1 MISSION shRNA Bacterial Glycerol Stock
transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011599.2-3202s1c1
Sequence:CCGGGCCAAATGTTTGGAATTTGTACTCGAGTACAAATTCCAAACATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011599.2-966s1c1
Sequence:CCGGGCGCAGTATCACAGTCTTAAACTCGAGTTTAAGACTGTGATACTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011599.2-1494s1c1
Sequence:CCGGCGCAGAAATGGTCCAGAGTTTCTCGAGAAACTCTGGACCATTTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011599.2-1373s1c1
Sequence:CCGGGCAGTCTCACTTGGCAATAAACTCGAGTTTATTGCCAAGTGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011599.2-1098s1c1
Sequence:CCGGGCCAAGAGATTGAACACCATTCTCGAGAATGGTGTTCAATCTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011599.4-1542s21c1
Sequence:CCGGGGCACAGATAAGCGCAGAAATCTCGAGATTTCTGCGCTTATCTGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011599.4-2891s21c1
Sequence:CCGGGATCTTCTCTTTGGGATATTGCTCGAGCAATATCCCAAAGAGAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011599.4-1495s21c1
Sequence:CCGGGAGAGCCTGGCACGAGTAATTCTCGAGAATTACTCGTGCCAGGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011599.4-4021s21c1
Sequence:CCGGTACAGGCTCTTACACTATATTCTCGAGAATATAGTGTAAGAGCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011599.4-984s21c1
Sequence:CCGGGAGTCTCTGGACCGGATTAAACTCGAGTTTAATCCGGTCCAGAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011599
VALIDATED
TLE1 MISSION shRNA shRNA Plasmid DNA
transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011599.2-3202s1c1
Sequence:CCGGGCCAAATGTTTGGAATTTGTACTCGAGTACAAATTCCAAACATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011599.2-966s1c1
Sequence:CCGGGCGCAGTATCACAGTCTTAAACTCGAGTTTAAGACTGTGATACTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011599.2-1494s1c1
Sequence:CCGGCGCAGAAATGGTCCAGAGTTTCTCGAGAAACTCTGGACCATTTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011599.2-1373s1c1
Sequence:CCGGGCAGTCTCACTTGGCAATAAACTCGAGTTTATTGCCAAGTGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011599.2-1098s1c1
Sequence:CCGGGCCAAGAGATTGAACACCATTCTCGAGAATGGTGTTCAATCTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011599.4-1542s21c1
Sequence:CCGGGGCACAGATAAGCGCAGAAATCTCGAGATTTCTGCGCTTATCTGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011599.4-2891s21c1
Sequence:CCGGGATCTTCTCTTTGGGATATTGCTCGAGCAATATCCCAAAGAGAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011599.4-1495s21c1
Sequence:CCGGGAGAGCCTGGCACGAGTAATTCTCGAGAATTACTCGTGCCAGGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011599.4-4021s21c1
Sequence:CCGGTACAGGCTCTTACACTATATTCTCGAGAATATAGTGTAAGAGCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011599.4-984s21c1
Sequence:CCGGGAGTCTCTGGACCGGATTAAACTCGAGTTTAATCCGGTCCAGAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011599
VALIDATED
TLE1 MISSION shRNA Lentiviral Transduction Particles
transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011599.2-3202s1c1
Sequence:CCGGGCCAAATGTTTGGAATTTGTACTCGAGTACAAATTCCAAACATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011599.2-966s1c1
Sequence:CCGGGCGCAGTATCACAGTCTTAAACTCGAGTTTAAGACTGTGATACTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011599.2-1494s1c1
Sequence:CCGGCGCAGAAATGGTCCAGAGTTTCTCGAGAAACTCTGGACCATTTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011599.2-1373s1c1
Sequence:CCGGGCAGTCTCACTTGGCAATAAACTCGAGTTTATTGCCAAGTGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011599.2-1098s1c1
Sequence:CCGGGCCAAGAGATTGAACACCATTCTCGAGAATGGTGTTCAATCTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011599.4-1542s21c1
Sequence:CCGGGGCACAGATAAGCGCAGAAATCTCGAGATTTCTGCGCTTATCTGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011599.4-2891s21c1
Sequence:CCGGGATCTTCTCTTTGGGATATTGCTCGAGCAATATCCCAAAGAGAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011599.4-1495s21c1
Sequence:CCGGGAGAGCCTGGCACGAGTAATTCTCGAGAATTACTCGTGCCAGGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011599.4-4021s21c1
Sequence:CCGGTACAGGCTCTTACACTATATTCTCGAGAATATAGTGTAAGAGCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011599.4-984s21c1
Sequence:CCGGGAGTCTCTGGACCGGATTAAACTCGAGTTTAATCCGGTCCAGAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005077
VALIDATED
TLE1 MISSION shRNA Bacterial Glycerol Stock
transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005077.3-1271s1c1
Sequence:CCGGGCCTGCTAAAGAAGGATGCTTCTCGAGAAGCATCCTTCTTTAGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005077.3-1081s1c1
Sequence:CCGGCGCAGAAATGGACCTGAATTTCTCGAGAAATTCAGGTCCATTTCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005077.3-2245s1c1
Sequence:CCGGGATCTGCACAACCAGACACTACTCGAGTAGTGTCTGGTTGTGCAGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005077.3-2683s1c1
Sequence:CCGGTCTGTGGATGATAAGTACATACTCGAGTATGTACTTATCATCCACAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005077.3-1611s1c1
Sequence:CCGGCTACGCCAGTTTACACAACATCTCGAGATGTTGTGTAAACTGGCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005077.3-2018s21c1
Sequence:CCGGGTCTGAACAGAGACAATTATACTCGAGTATAATTGTCTCTGTTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005077.3-2761s21c1
Sequence:CCGGTATGTGGTTTAACGTTTATAGCTCGAGCTATAAACGTTAAACCACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005077.3-1081s21c1
Sequence:CCGGCGCAGAAATGGACCTGAATTTCTCGAGAAATTCAGGTCCATTTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005077.3-2245s21c1
Sequence:CCGGGATCTGCACAACCAGACACTACTCGAGTAGTGTCTGGTTGTGCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005077.3-1318s21c1
Sequence:CCGGTCGGCAAGTTCCACTTCTTTGCTCGAGCAAAGAAGTGGAACTTGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005077
VALIDATED
TLE1 MISSION shRNA shRNA Plasmid DNA
transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005077.3-1271s1c1
Sequence:CCGGGCCTGCTAAAGAAGGATGCTTCTCGAGAAGCATCCTTCTTTAGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005077.3-1081s1c1
Sequence:CCGGCGCAGAAATGGACCTGAATTTCTCGAGAAATTCAGGTCCATTTCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005077.3-2245s1c1
Sequence:CCGGGATCTGCACAACCAGACACTACTCGAGTAGTGTCTGGTTGTGCAGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005077.3-2683s1c1
Sequence:CCGGTCTGTGGATGATAAGTACATACTCGAGTATGTACTTATCATCCACAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005077.3-1611s1c1
Sequence:CCGGCTACGCCAGTTTACACAACATCTCGAGATGTTGTGTAAACTGGCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005077.3-2018s21c1
Sequence:CCGGGTCTGAACAGAGACAATTATACTCGAGTATAATTGTCTCTGTTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005077.3-2761s21c1
Sequence:CCGGTATGTGGTTTAACGTTTATAGCTCGAGCTATAAACGTTAAACCACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005077.3-1081s21c1
Sequence:CCGGCGCAGAAATGGACCTGAATTTCTCGAGAAATTCAGGTCCATTTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005077.3-2245s21c1
Sequence:CCGGGATCTGCACAACCAGACACTACTCGAGTAGTGTCTGGTTGTGCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005077.3-1318s21c1
Sequence:CCGGTCGGCAAGTTCCACTTCTTTGCTCGAGCAAAGAAGTGGAACTTGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005077
VALIDATED
TLE1 MISSION shRNA Lentiviral Transduction Particles
transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005077.3-1271s1c1
Sequence:CCGGGCCTGCTAAAGAAGGATGCTTCTCGAGAAGCATCCTTCTTTAGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005077.3-1081s1c1
Sequence:CCGGCGCAGAAATGGACCTGAATTTCTCGAGAAATTCAGGTCCATTTCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005077.3-2245s1c1
Sequence:CCGGGATCTGCACAACCAGACACTACTCGAGTAGTGTCTGGTTGTGCAGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005077.3-2683s1c1
Sequence:CCGGTCTGTGGATGATAAGTACATACTCGAGTATGTACTTATCATCCACAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005077.3-1611s1c1
Sequence:CCGGCTACGCCAGTTTACACAACATCTCGAGATGTTGTGTAAACTGGCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005077.3-2018s21c1
Sequence:CCGGGTCTGAACAGAGACAATTATACTCGAGTATAATTGTCTCTGTTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005077.3-2761s21c1
Sequence:CCGGTATGTGGTTTAACGTTTATAGCTCGAGCTATAAACGTTAAACCACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005077.3-1081s21c1
Sequence:CCGGCGCAGAAATGGACCTGAATTTCTCGAGAAATTCAGGTCCATTTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005077.3-2245s21c1
Sequence:CCGGGATCTGCACAACCAGACACTACTCGAGTAGTGTCTGGTTGTGCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005077.3-1318s21c1
Sequence:CCGGTCGGCAAGTTCCACTTCTTTGCTCGAGCAAAGAAGTGGAACTTGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks