EMAIL THIS PAGE TO A FRIEND

TLE2

transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila)

Synonyms: ESG ESG2 GRG2
UniProtKB ID: Q04725, B4DE03, E9PEV7, F8WCH2, Q8WVY0, Q9Y6S0
Gene ID:
Mouse(21886) transducin-like enhancer of split 2, homolog of Drosophila E(spl)
Rat(299636) transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila)
Zebrafish(565013) transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila)
domestic cat(101082981) transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila)
domestic guinea pig(100715634) transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila)
naked mole-rat(101723443) transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila)
cow(533595) transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila)
sheep(101118525) transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila)
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003260 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003260 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003260 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019725 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019725 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019725 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU076091 MISSION® esiRNA esiRNA human TLE2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003260 Rosetta Predictions human pricing
NM_001039013 Rosetta Predictions rat pricing
NM_019725 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003260 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211392 predicted 792
2 SASI_Hs01_00211393 predicted 369
3 SASI_Hs01_00211394 predicted 799
4 SASI_Hs02_00335312 predicted 2268
5 SASI_Hs01_00211395 predicted 1891
6 SASI_Hs01_00211396 predicted 2070
7 SASI_Hs02_00335313 predicted 785
8 SASI_Hs01_00211397 predicted 273
9 SASI_Hs01_00211398 predicted 2316
10 SASI_Hs01_00211400 predicted 877
11 SASI_Hs01_00211399 predicted 330
12 SASI_Hs01_00211401 predicted 2335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039013 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114727 predicted 868
2 SASI_Rn01_00114728 predicted 848
3 SASI_Rn01_00114729 predicted 2157
4 SASI_Rn01_00114730 predicted 408
5 SASI_Rn01_00114731 predicted 379
6 SASI_Rn01_00114732 predicted 874
7 SASI_Rn02_00204743 predicted 1030
8 SASI_Rn01_00114734 predicted 292
9 SASI_Rn01_00114735 predicted 286
10 SASI_Rn01_00114736 predicted 1738
11 SASI_Rn01_00114733 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019725 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324849 predicted 389
2 SASI_Mm02_00324850 predicted 889
3 SASI_Mm02_00324851 predicted 1243
4 SASI_Mm02_00324852 predicted 2332
5 SASI_Mm02_00324853 predicted 2340
6 SASI_Mm02_00324854 predicted 426
7 SASI_Mm02_00324855 predicted 873
8 SASI_Mm02_00324856 predicted 907
9 SASI_Mm02_00324857 predicted 412
10 SASI_Mm02_00324858 predicted 1908
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003260
VALIDATED
TLE2 MISSION shRNA Bacterial Glycerol Stock
transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003260.3-1632s21c1
Sequence:CCGGCTACATTCGTTCCTGCAAGTTCTCGAGAACTTGCAGGAACGAATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003260.3-2268s21c1
Sequence:CCGGGAGTTGTGACATCTCCAGAAACTCGAGTTTCTGGAGATGTCACAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003260.3-803s21c1
Sequence:CCGGGCGACGAAGACAAGAGTGATTCTCGAGAATCACTCTTGTCTTCGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003260.3-327s21c1
Sequence:CCGGGCTCAACATTGAAATGCATAACTCGAGTTATGCATTTCAATGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003260.3-1898s21c1
Sequence:CCGGGCTGCATTGATATTTCCGATTCTCGAGAATCGGAAATATCAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003260.3-803s1c1
Sequence:CCGGGCGACGAAGACAAGAGTGATTCTCGAGAATCACTCTTGTCTTCGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003260.3-1898s1c1
Sequence:CCGGGCTGCATTGATATTTCCGATTCTCGAGAATCGGAAATATCAATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003260.3-1632s1c1
Sequence:CCGGCTACATTCGTTCCTGCAAGTTCTCGAGAACTTGCAGGAACGAATGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003260.3-2268s1c1
Sequence:CCGGGAGTTGTGACATCTCCAGAAACTCGAGTTTCTGGAGATGTCACAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003260.3-327s1c1
Sequence:CCGGGCTCAACATTGAAATGCATAACTCGAGTTATGCATTTCAATGTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003260
VALIDATED
TLE2 MISSION shRNA shRNA Plasmid DNA
transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003260.3-1632s21c1
Sequence:CCGGCTACATTCGTTCCTGCAAGTTCTCGAGAACTTGCAGGAACGAATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003260.3-2268s21c1
Sequence:CCGGGAGTTGTGACATCTCCAGAAACTCGAGTTTCTGGAGATGTCACAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003260.3-803s21c1
Sequence:CCGGGCGACGAAGACAAGAGTGATTCTCGAGAATCACTCTTGTCTTCGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003260.3-327s21c1
Sequence:CCGGGCTCAACATTGAAATGCATAACTCGAGTTATGCATTTCAATGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003260.3-1898s21c1
Sequence:CCGGGCTGCATTGATATTTCCGATTCTCGAGAATCGGAAATATCAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003260.3-803s1c1
Sequence:CCGGGCGACGAAGACAAGAGTGATTCTCGAGAATCACTCTTGTCTTCGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003260.3-1898s1c1
Sequence:CCGGGCTGCATTGATATTTCCGATTCTCGAGAATCGGAAATATCAATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003260.3-1632s1c1
Sequence:CCGGCTACATTCGTTCCTGCAAGTTCTCGAGAACTTGCAGGAACGAATGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003260.3-2268s1c1
Sequence:CCGGGAGTTGTGACATCTCCAGAAACTCGAGTTTCTGGAGATGTCACAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003260.3-327s1c1
Sequence:CCGGGCTCAACATTGAAATGCATAACTCGAGTTATGCATTTCAATGTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003260
VALIDATED
TLE2 MISSION shRNA Lentiviral Transduction Particles
transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003260.3-1632s21c1
Sequence:CCGGCTACATTCGTTCCTGCAAGTTCTCGAGAACTTGCAGGAACGAATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003260.3-2268s21c1
Sequence:CCGGGAGTTGTGACATCTCCAGAAACTCGAGTTTCTGGAGATGTCACAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003260.3-803s21c1
Sequence:CCGGGCGACGAAGACAAGAGTGATTCTCGAGAATCACTCTTGTCTTCGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003260.3-327s21c1
Sequence:CCGGGCTCAACATTGAAATGCATAACTCGAGTTATGCATTTCAATGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003260.3-1898s21c1
Sequence:CCGGGCTGCATTGATATTTCCGATTCTCGAGAATCGGAAATATCAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003260.3-803s1c1
Sequence:CCGGGCGACGAAGACAAGAGTGATTCTCGAGAATCACTCTTGTCTTCGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003260.3-1898s1c1
Sequence:CCGGGCTGCATTGATATTTCCGATTCTCGAGAATCGGAAATATCAATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003260.3-1632s1c1
Sequence:CCGGCTACATTCGTTCCTGCAAGTTCTCGAGAACTTGCAGGAACGAATGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003260.3-2268s1c1
Sequence:CCGGGAGTTGTGACATCTCCAGAAACTCGAGTTTCTGGAGATGTCACAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003260.3-327s1c1
Sequence:CCGGGCTCAACATTGAAATGCATAACTCGAGTTATGCATTTCAATGTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019725
VALIDATED
TLE2 MISSION shRNA Bacterial Glycerol Stock
transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019725.1-2531s21c1
Sequence:CCGGAGAGCTGGATCAGGGATTTACCTCGAGGTAAATCCCTGATCCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019725.1-1987s21c1
Sequence:CCGGCTGCATCGACATATCAGACTACTCGAGTAGTCTGATATGTCGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019725.1-203s21c1
Sequence:CCGGGAAATCTGTGACCGGATCAAACTCGAGTTTGATCCGGTCACAGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019725.1-899s21c1
Sequence:CCGGGAAGACAAGAGTGACTATAACCTCGAGGTTATAGTCACTCTTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019725.1-1350s21c1
Sequence:CCGGTCAGCAGCTCTGTCGTGTATGCTCGAGCATACACGACAGAGCTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019725.1-2573s1c1
Sequence:CCGGGTGTGGGCTTTACCAACTGAACTCGAGTTCAGTTGGTAAAGCCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019725.1-259s1c1
Sequence:CCGGCCTCAAGCTAGAATGTGAGAACTCGAGTTCTCACATTCTAGCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019725.1-413s1c1
Sequence:CCGGCTCAACATTGAGATGCATAAACTCGAGTTTATGCATCTCAATGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019725.1-1987s1c1
Sequence:CCGGCTGCATCGACATATCAGACTACTCGAGTAGTCTGATATGTCGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019725.1-203s1c1
Sequence:CCGGGAAATCTGTGACCGGATCAAACTCGAGTTTGATCCGGTCACAGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019725
VALIDATED
TLE2 MISSION shRNA shRNA Plasmid DNA
transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019725.1-2531s21c1
Sequence:CCGGAGAGCTGGATCAGGGATTTACCTCGAGGTAAATCCCTGATCCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019725.1-1987s21c1
Sequence:CCGGCTGCATCGACATATCAGACTACTCGAGTAGTCTGATATGTCGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019725.1-203s21c1
Sequence:CCGGGAAATCTGTGACCGGATCAAACTCGAGTTTGATCCGGTCACAGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019725.1-899s21c1
Sequence:CCGGGAAGACAAGAGTGACTATAACCTCGAGGTTATAGTCACTCTTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019725.1-1350s21c1
Sequence:CCGGTCAGCAGCTCTGTCGTGTATGCTCGAGCATACACGACAGAGCTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019725.1-2573s1c1
Sequence:CCGGGTGTGGGCTTTACCAACTGAACTCGAGTTCAGTTGGTAAAGCCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019725.1-259s1c1
Sequence:CCGGCCTCAAGCTAGAATGTGAGAACTCGAGTTCTCACATTCTAGCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019725.1-413s1c1
Sequence:CCGGCTCAACATTGAGATGCATAAACTCGAGTTTATGCATCTCAATGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019725.1-1987s1c1
Sequence:CCGGCTGCATCGACATATCAGACTACTCGAGTAGTCTGATATGTCGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019725.1-203s1c1
Sequence:CCGGGAAATCTGTGACCGGATCAAACTCGAGTTTGATCCGGTCACAGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019725
VALIDATED
TLE2 MISSION shRNA Lentiviral Transduction Particles
transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019725.1-2531s21c1
Sequence:CCGGAGAGCTGGATCAGGGATTTACCTCGAGGTAAATCCCTGATCCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019725.1-1987s21c1
Sequence:CCGGCTGCATCGACATATCAGACTACTCGAGTAGTCTGATATGTCGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019725.1-203s21c1
Sequence:CCGGGAAATCTGTGACCGGATCAAACTCGAGTTTGATCCGGTCACAGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019725.1-899s21c1
Sequence:CCGGGAAGACAAGAGTGACTATAACCTCGAGGTTATAGTCACTCTTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019725.1-1350s21c1
Sequence:CCGGTCAGCAGCTCTGTCGTGTATGCTCGAGCATACACGACAGAGCTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019725.1-2573s1c1
Sequence:CCGGGTGTGGGCTTTACCAACTGAACTCGAGTTCAGTTGGTAAAGCCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019725.1-259s1c1
Sequence:CCGGCCTCAAGCTAGAATGTGAGAACTCGAGTTCTCACATTCTAGCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019725.1-413s1c1
Sequence:CCGGCTCAACATTGAGATGCATAAACTCGAGTTTATGCATCTCAATGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019725.1-1987s1c1
Sequence:CCGGCTGCATCGACATATCAGACTACTCGAGTAGTCTGATATGTCGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019725.1-203s1c1
Sequence:CCGGGAAATCTGTGACCGGATCAAACTCGAGTTTGATCCGGTCACAGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks