EMAIL THIS PAGE TO A FRIEND

TLE3

transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)

Synonyms: ESG ESG3 GRG3 HsT18976
UniProtKB ID: Q04726, E9PD64, Q8IVV6, Q8WVR2, Q9HCM5
Gene ID:
Mouse(21887) transducin-like enhancer of split 3, homolog of Drosophila E(spl)
Rat(84424) transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)
cow(514326) transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)
sheep(101107283) transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)
naked mole-rat(101698530) transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)
domestic guinea pig(100732785) transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)
chicken(415568) transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)
dog(487624) transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)
domestic cat(101095342) transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)
Horse(100052464) transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009389 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009389 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009389 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005078 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005078 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005078 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105192 Rosetta Predictions human pricing
NM_005078 Rosetta Predictions human pricing
NM_020908 Rosetta Predictions human pricing
NM_053400 Rosetta Predictions rat pricing
NM_001083927 Rosetta Predictions mouse pricing
NM_001083928 Rosetta Predictions mouse pricing
NM_009389 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105192 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323894 predicted 3408
2 SASI_Hs02_00323895 predicted 3351
3 SASI_Hs02_00323896 predicted 2445
4 SASI_Hs02_00323897 predicted 2448
5 SASI_Hs02_00323898 predicted 1326
6 SASI_Hs02_00323899 predicted 3337
7 SASI_Hs02_00323900 predicted 1382
8 SASI_Hs02_00323901 predicted 3404
9 SASI_Hs02_00323902 predicted 1694
10 SASI_Hs02_00323903 predicted 1383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338916 predicted 3426
2 SASI_Hs02_00338917 predicted 3351
3 SASI_Hs01_00154650 predicted 2452
4 SASI_Hs01_00154651 predicted 2463
5 SASI_Hs02_00338918 predicted 1324
6 SASI_Hs02_00338919 predicted 3340
7 SASI_Hs01_00154653 predicted 1386
8 SASI_Hs02_00338920 predicted 3415
9 SASI_Hs01_00154655 predicted 1700
10 SASI_Hs01_00154656 predicted 1382
11 SASI_Hs01_00154652 predicted 1773
12 SASI_Hs01_00154654 predicted 595
13 SASI_Hs01_00154657 predicted 1150
14 SASI_Hs01_00154658 predicted 1264
15 SASI_Hs01_00154659 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020908 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354244 predicted 3387
2 SASI_Hs02_00354245 predicted 3316
3 SASI_Hs02_00354246 predicted 2417
4 SASI_Hs02_00354247 predicted 2428
5 SASI_Hs02_00354248 predicted 1319
6 SASI_Hs02_00354249 predicted 3312
7 SASI_Hs02_00354250 predicted 1381
8 SASI_Hs02_00354251 predicted 3379
9 SASI_Hs02_00354252 predicted 1693
10 SASI_Hs02_00354253 predicted 1387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053400 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043837 predicted 1404
2 SASI_Rn01_00043838 predicted 2687
3 SASI_Rn02_00265902 predicted 2578
4 SASI_Rn01_00043840 predicted 2864
5 SASI_Rn01_00043841 predicted 2926
6 SASI_Rn01_00043842 predicted 3039
7 SASI_Rn01_00043843 predicted 2957
8 SASI_Rn01_00043844 predicted 2172
9 SASI_Rn01_00043845 predicted 1859
10 SASI_Rn01_00043846 predicted 1844
11 SASI_Rn01_00043839 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083927 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300046 predicted 3409
2 SASI_Mm02_00300047 predicted 3073
3 SASI_Mm02_00300048 predicted 2979
4 SASI_Mm02_00300049 predicted 2966
5 SASI_Mm02_00300050 predicted 2885
6 SASI_Mm02_00300051 predicted 3049
7 SASI_Mm02_00300052 predicted 1765
8 SASI_Mm02_00300053 predicted 3251
9 SASI_Mm02_00300054 predicted 2968
10 SASI_Mm02_00300055 predicted 3424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083928 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300056 predicted 3347
2 SASI_Mm02_00300057 predicted 3025
3 SASI_Mm02_00300058 predicted 2925
4 SASI_Mm02_00300059 predicted 2908
5 SASI_Mm02_00300060 predicted 2834
6 SASI_Mm02_00300061 predicted 2995
7 SASI_Mm02_00300062 predicted 1742
8 SASI_Mm02_00300063 predicted 3199
9 SASI_Mm02_00300064 predicted 2913
10 SASI_Mm02_00300065 predicted 3366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009389 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316003 predicted 3376
2 SASI_Mm02_00316004 predicted 3052
3 SASI_Mm01_00025292 predicted 2948
4 SASI_Mm01_00025293 predicted 2931
5 SASI_Mm02_00316005 predicted 2864
6 SASI_Mm01_00025294 predicted 3017
7 SASI_Mm01_00025295 predicted 1742
8 SASI_Mm01_00025296 predicted 3219
9 SASI_Mm02_00316006 predicted 2938
10 SASI_Mm01_00025297 predicted 3396
11 SASI_Mm01_00025298 predicted 2319
12 SASI_Mm01_00025299 predicted 2522
13 SASI_Mm01_00025300 predicted 2534
14 SASI_Mm01_00025301 predicted 1368
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009389
VALIDATED
TLE3 MISSION shRNA Bacterial Glycerol Stock
transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009389.1-2580s1c1
Sequence:CCGGGACTCTAACAGGCCTGTCAAACTCGAGTTTGACAGGCCTGTTAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009389.1-2506s1c1
Sequence:CCGGGCGGATGACAAATATATTGTACTCGAGTACAATATATTTGTCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009389.1-958s1c1
Sequence:CCGGCTCAGCAGATACGATAGCGATCTCGAGATCGCTATCGTATCTGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009389.1-2316s1c1
Sequence:CCGGCCACACTAAGCCCGACAAATACTCGAGTATTTGTCGGGCTTAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009389.1-429s1c1
Sequence:CCGGGCGCCATTATGTGATGTACTACTCGAGTAGTACATCACATAATGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009389.2-3012s21c1
Sequence:CCGGTACGTGAAGGACGGCAGTTACCTCGAGGTAACTGCCGTCCTTCACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009389.2-1974s21c1
Sequence:CCGGCCAAAGACCTTGGTCATAATGCTCGAGCATTATGACCAAGGTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442749    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009389.2-3793s21c1
Sequence:CCGGGGTTTGTGAACAGTGTAAATACTCGAGTATTTACACTGTTCACAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009389.2-1316s21c1
Sequence:CCGGGCGAAGAGACTGAACACAATCCTCGAGGATTGTGTTCAGTCTCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009389.2-1269s21c1
Sequence:CCGGAGATGTCCTATGGCTTGAATACTCGAGTATTCAAGCCATAGGACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009389.2-3355s21c1
Sequence:CCGGTGACAAGAAGGCCACAGTTTACTCGAGTAAACTGTGGCCTTCTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009389
VALIDATED
TLE3 MISSION shRNA shRNA Plasmid DNA
transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009389.1-2580s1c1
Sequence:CCGGGACTCTAACAGGCCTGTCAAACTCGAGTTTGACAGGCCTGTTAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009389.1-2506s1c1
Sequence:CCGGGCGGATGACAAATATATTGTACTCGAGTACAATATATTTGTCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009389.1-958s1c1
Sequence:CCGGCTCAGCAGATACGATAGCGATCTCGAGATCGCTATCGTATCTGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009389.1-2316s1c1
Sequence:CCGGCCACACTAAGCCCGACAAATACTCGAGTATTTGTCGGGCTTAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009389.1-429s1c1
Sequence:CCGGGCGCCATTATGTGATGTACTACTCGAGTAGTACATCACATAATGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009389.2-3012s21c1
Sequence:CCGGTACGTGAAGGACGGCAGTTACCTCGAGGTAACTGCCGTCCTTCACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009389.2-1974s21c1
Sequence:CCGGCCAAAGACCTTGGTCATAATGCTCGAGCATTATGACCAAGGTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442749    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009389.2-3793s21c1
Sequence:CCGGGGTTTGTGAACAGTGTAAATACTCGAGTATTTACACTGTTCACAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009389.2-1316s21c1
Sequence:CCGGGCGAAGAGACTGAACACAATCCTCGAGGATTGTGTTCAGTCTCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009389.2-1269s21c1
Sequence:CCGGAGATGTCCTATGGCTTGAATACTCGAGTATTCAAGCCATAGGACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009389.2-3355s21c1
Sequence:CCGGTGACAAGAAGGCCACAGTTTACTCGAGTAAACTGTGGCCTTCTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009389
VALIDATED
TLE3 MISSION shRNA Lentiviral Transduction Particles
transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009389.1-2580s1c1
Sequence:CCGGGACTCTAACAGGCCTGTCAAACTCGAGTTTGACAGGCCTGTTAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009389.1-2506s1c1
Sequence:CCGGGCGGATGACAAATATATTGTACTCGAGTACAATATATTTGTCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009389.1-958s1c1
Sequence:CCGGCTCAGCAGATACGATAGCGATCTCGAGATCGCTATCGTATCTGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009389.1-2316s1c1
Sequence:CCGGCCACACTAAGCCCGACAAATACTCGAGTATTTGTCGGGCTTAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009389.1-429s1c1
Sequence:CCGGGCGCCATTATGTGATGTACTACTCGAGTAGTACATCACATAATGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009389.2-3012s21c1
Sequence:CCGGTACGTGAAGGACGGCAGTTACCTCGAGGTAACTGCCGTCCTTCACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009389.2-1974s21c1
Sequence:CCGGCCAAAGACCTTGGTCATAATGCTCGAGCATTATGACCAAGGTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442749    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009389.2-3793s21c1
Sequence:CCGGGGTTTGTGAACAGTGTAAATACTCGAGTATTTACACTGTTCACAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009389.2-1316s21c1
Sequence:CCGGGCGAAGAGACTGAACACAATCCTCGAGGATTGTGTTCAGTCTCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009389.2-1269s21c1
Sequence:CCGGAGATGTCCTATGGCTTGAATACTCGAGTATTCAAGCCATAGGACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009389.2-3355s21c1
Sequence:CCGGTGACAAGAAGGCCACAGTTTACTCGAGTAAACTGTGGCCTTCTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005078
TLE3 MISSION shRNA Bacterial Glycerol Stock
transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005078.1-196s1c1
Sequence:CCGGCGCCATTATGTGATGTACTATCTCGAGATAGTACATCACATAATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005078.1-1360s1c1
Sequence:CCGGGCGTACTCATTCCATGTGAGTCTCGAGACTCACATGGAATGAGTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005078.1-1885s1c1
Sequence:CCGGAGCTGCATAGACATCTCCCATCTCGAGATGGGAGATGTCTATGCAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005078.1-224s1c1
Sequence:CCGGCCTATGGCTTGAACATTGAAACTCGAGTTTCAATGTTCAAGCCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005078.1-600s1c1
Sequence:CCGGGAGAGAATCCAGTGCGAATAACTCGAGTTATTCGCACTGGATTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005078.2-3697s21c1
Sequence:CCGGTAGATTTATTGGAGGCTTATGCTCGAGCATAAGCCTCCAATAAATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005078.2-3419s21c1
Sequence:CCGGTTTATGAGGTCATCTACTAAACTCGAGTTTAGTAGATGACCTCATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005078.2-1857s21c1
Sequence:CCGGTGATCTGGTGGTGGATGTTTCCTCGAGGAAACATCCACCACCAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005078
TLE3 MISSION shRNA shRNA Plasmid DNA
transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005078.1-196s1c1
Sequence:CCGGCGCCATTATGTGATGTACTATCTCGAGATAGTACATCACATAATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005078.1-1360s1c1
Sequence:CCGGGCGTACTCATTCCATGTGAGTCTCGAGACTCACATGGAATGAGTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005078.1-1885s1c1
Sequence:CCGGAGCTGCATAGACATCTCCCATCTCGAGATGGGAGATGTCTATGCAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005078.1-224s1c1
Sequence:CCGGCCTATGGCTTGAACATTGAAACTCGAGTTTCAATGTTCAAGCCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005078.1-600s1c1
Sequence:CCGGGAGAGAATCCAGTGCGAATAACTCGAGTTATTCGCACTGGATTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005078.2-3697s21c1
Sequence:CCGGTAGATTTATTGGAGGCTTATGCTCGAGCATAAGCCTCCAATAAATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005078.2-3419s21c1
Sequence:CCGGTTTATGAGGTCATCTACTAAACTCGAGTTTAGTAGATGACCTCATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005078.2-1857s21c1
Sequence:CCGGTGATCTGGTGGTGGATGTTTCCTCGAGGAAACATCCACCACCAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005078
TLE3 MISSION shRNA Lentiviral Transduction Particles
transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005078.1-196s1c1
Sequence:CCGGCGCCATTATGTGATGTACTATCTCGAGATAGTACATCACATAATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005078.1-1360s1c1
Sequence:CCGGGCGTACTCATTCCATGTGAGTCTCGAGACTCACATGGAATGAGTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005078.1-1885s1c1
Sequence:CCGGAGCTGCATAGACATCTCCCATCTCGAGATGGGAGATGTCTATGCAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005078.1-224s1c1
Sequence:CCGGCCTATGGCTTGAACATTGAAACTCGAGTTTCAATGTTCAAGCCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005078.1-600s1c1
Sequence:CCGGGAGAGAATCCAGTGCGAATAACTCGAGTTATTCGCACTGGATTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005078.2-3697s21c1
Sequence:CCGGTAGATTTATTGGAGGCTTATGCTCGAGCATAAGCCTCCAATAAATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005078.2-3419s21c1
Sequence:CCGGTTTATGAGGTCATCTACTAAACTCGAGTTTAGTAGATGACCTCATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005078.2-1857s21c1
Sequence:CCGGTGATCTGGTGGTGGATGTTTCCTCGAGGAAACATCCACCACCAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks